Multiple sequence alignment - TraesCS7D01G239100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G239100 chr7D 100.000 2724 0 0 1 2724 203554850 203552127 0 5031
1 TraesCS7D01G239100 chrUn 99.523 2724 11 2 2 2724 189394036 189396758 0 4957
2 TraesCS7D01G239100 chr5B 99.339 2723 16 2 2 2724 679660394 679663114 0 4927
3 TraesCS7D01G239100 chr5A 99.192 2723 20 2 2 2724 16601426 16598706 0 4905
4 TraesCS7D01G239100 chr5A 98.972 2724 25 3 2 2724 300074476 300077197 0 4872
5 TraesCS7D01G239100 chr7B 99.155 2723 21 2 2 2724 743087696 743090416 0 4900
6 TraesCS7D01G239100 chr4D 99.082 2723 21 2 2 2724 123414379 123417097 0 4887
7 TraesCS7D01G239100 chr6A 99.008 2723 25 2 2 2724 289130127 289132847 0 4878
8 TraesCS7D01G239100 chr2A 98.751 2723 30 3 2 2724 735194151 735196869 0 4837
9 TraesCS7D01G239100 chr3B 98.678 2723 33 3 2 2724 92201098 92203817 0 4826


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G239100 chr7D 203552127 203554850 2723 True 5031 5031 100.000 1 2724 1 chr7D.!!$R1 2723
1 TraesCS7D01G239100 chrUn 189394036 189396758 2722 False 4957 4957 99.523 2 2724 1 chrUn.!!$F1 2722
2 TraesCS7D01G239100 chr5B 679660394 679663114 2720 False 4927 4927 99.339 2 2724 1 chr5B.!!$F1 2722
3 TraesCS7D01G239100 chr5A 16598706 16601426 2720 True 4905 4905 99.192 2 2724 1 chr5A.!!$R1 2722
4 TraesCS7D01G239100 chr5A 300074476 300077197 2721 False 4872 4872 98.972 2 2724 1 chr5A.!!$F1 2722
5 TraesCS7D01G239100 chr7B 743087696 743090416 2720 False 4900 4900 99.155 2 2724 1 chr7B.!!$F1 2722
6 TraesCS7D01G239100 chr4D 123414379 123417097 2718 False 4887 4887 99.082 2 2724 1 chr4D.!!$F1 2722
7 TraesCS7D01G239100 chr6A 289130127 289132847 2720 False 4878 4878 99.008 2 2724 1 chr6A.!!$F1 2722
8 TraesCS7D01G239100 chr2A 735194151 735196869 2718 False 4837 4837 98.751 2 2724 1 chr2A.!!$F1 2722
9 TraesCS7D01G239100 chr3B 92201098 92203817 2719 False 4826 4826 98.678 2 2724 1 chr3B.!!$F1 2722

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
31 32 2.140792 ACCCGCCCGCTCTCAATAT 61.141 57.895 0.00 0.00 0.00 1.28 F
176 177 6.262273 GCTAATAGAAGCCGAGCTATCTATCT 59.738 42.308 18.71 12.42 38.25 1.98 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1355 1357 1.224592 GAGCATCCCACACCCGAAT 59.775 57.895 0.0 0.0 0.00 3.34 R
2341 2344 1.344942 CGAGAAACCCTTCACTCGCG 61.345 60.000 0.0 0.0 43.71 5.87 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
31 32 2.140792 ACCCGCCCGCTCTCAATAT 61.141 57.895 0.00 0.00 0.00 1.28
176 177 6.262273 GCTAATAGAAGCCGAGCTATCTATCT 59.738 42.308 18.71 12.42 38.25 1.98
1026 1027 8.836268 TGTCAGTTTCGTTATTACAACCTTAT 57.164 30.769 0.00 0.00 0.00 1.73
2341 2344 6.773976 TCAACACATCTATTTGAATTCCCC 57.226 37.500 2.27 0.00 0.00 4.81
2353 2356 2.536997 AATTCCCCGCGAGTGAAGGG 62.537 60.000 8.23 8.93 44.67 3.95
2382 2385 5.245301 TCGTATGGAGAAAAACCTCTTGAGA 59.755 40.000 0.00 0.00 33.79 3.27
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 0.814457 GGCGGGTGACATGCATTAAA 59.186 50.000 0.00 0.0 35.19 1.52
31 32 3.756117 TGTGAGAGAGAGTCACTTGCTA 58.244 45.455 4.96 0.0 44.02 3.49
176 177 2.416836 CGCTTCGTTCAACCCTGATCTA 60.417 50.000 0.00 0.0 0.00 1.98
595 596 1.203523 GGGTGAGTAGAGTCTGTGCTG 59.796 57.143 1.86 0.0 0.00 4.41
1355 1357 1.224592 GAGCATCCCACACCCGAAT 59.775 57.895 0.00 0.0 0.00 3.34
2341 2344 1.344942 CGAGAAACCCTTCACTCGCG 61.345 60.000 0.00 0.0 43.71 5.87


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.