Multiple sequence alignment - TraesCS7D01G239000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G239000 chr7D 100.000 3188 0 0 1 3188 203530176 203526989 0.000000e+00 5888
1 TraesCS7D01G239000 chr7D 98.905 3195 27 4 1 3188 381882014 381878821 0.000000e+00 5699
2 TraesCS7D01G239000 chr7D 95.944 2490 90 6 1 2483 307185392 307182907 0.000000e+00 4028
3 TraesCS7D01G239000 chr7D 96.348 712 26 0 2477 3188 307179567 307178856 0.000000e+00 1171
4 TraesCS7D01G239000 chr7D 99.127 229 1 1 2115 2342 18404107 18404335 8.230000e-111 411
5 TraesCS7D01G239000 chr7D 98.824 85 1 0 2307 2391 404384564 404384480 5.510000e-33 152
6 TraesCS7D01G239000 chr2D 98.498 3195 40 4 1 3188 635019101 635022294 0.000000e+00 5627
7 TraesCS7D01G239000 chr2D 98.742 159 2 0 2337 2495 425290996 425291154 1.870000e-72 283
8 TraesCS7D01G239000 chr4D 98.435 3194 43 3 1 3188 123731202 123728010 0.000000e+00 5614
9 TraesCS7D01G239000 chr4D 97.871 3194 58 6 1 3188 134969072 134972261 0.000000e+00 5513
10 TraesCS7D01G239000 chr3D 97.307 3194 64 6 1 3188 501892035 501895212 0.000000e+00 5402
11 TraesCS7D01G239000 chrUn 98.774 2284 20 3 1 2276 223715542 223717825 0.000000e+00 4056
12 TraesCS7D01G239000 chrUn 98.864 1408 15 1 1765 3171 402971007 402972414 0.000000e+00 2510
13 TraesCS7D01G239000 chrUn 98.390 621 10 0 2568 3188 381709206 381708586 0.000000e+00 1092
14 TraesCS7D01G239000 chr2A 98.633 2194 22 4 1 2186 755521021 755518828 0.000000e+00 3879
15 TraesCS7D01G239000 chr5B 98.358 2193 28 4 1 2186 127798277 127796086 0.000000e+00 3843
16 TraesCS7D01G239000 chr6D 97.413 773 19 1 2417 3188 425976144 425976916 0.000000e+00 1315
17 TraesCS7D01G239000 chr6B 96.809 188 6 0 2414 2601 197526834 197526647 6.640000e-82 315


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G239000 chr7D 203526989 203530176 3187 True 5888.0 5888 100.000 1 3188 1 chr7D.!!$R1 3187
1 TraesCS7D01G239000 chr7D 381878821 381882014 3193 True 5699.0 5699 98.905 1 3188 1 chr7D.!!$R2 3187
2 TraesCS7D01G239000 chr7D 307178856 307185392 6536 True 2599.5 4028 96.146 1 3188 2 chr7D.!!$R4 3187
3 TraesCS7D01G239000 chr2D 635019101 635022294 3193 False 5627.0 5627 98.498 1 3188 1 chr2D.!!$F2 3187
4 TraesCS7D01G239000 chr4D 123728010 123731202 3192 True 5614.0 5614 98.435 1 3188 1 chr4D.!!$R1 3187
5 TraesCS7D01G239000 chr4D 134969072 134972261 3189 False 5513.0 5513 97.871 1 3188 1 chr4D.!!$F1 3187
6 TraesCS7D01G239000 chr3D 501892035 501895212 3177 False 5402.0 5402 97.307 1 3188 1 chr3D.!!$F1 3187
7 TraesCS7D01G239000 chrUn 223715542 223717825 2283 False 4056.0 4056 98.774 1 2276 1 chrUn.!!$F1 2275
8 TraesCS7D01G239000 chrUn 402971007 402972414 1407 False 2510.0 2510 98.864 1765 3171 1 chrUn.!!$F2 1406
9 TraesCS7D01G239000 chrUn 381708586 381709206 620 True 1092.0 1092 98.390 2568 3188 1 chrUn.!!$R1 620
10 TraesCS7D01G239000 chr2A 755518828 755521021 2193 True 3879.0 3879 98.633 1 2186 1 chr2A.!!$R1 2185
11 TraesCS7D01G239000 chr5B 127796086 127798277 2191 True 3843.0 3843 98.358 1 2186 1 chr5B.!!$R1 2185
12 TraesCS7D01G239000 chr6D 425976144 425976916 772 False 1315.0 1315 97.413 2417 3188 1 chr6D.!!$F1 771

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
925 933 4.527816 TGCAGCTTTTTGATTATTCAGGGT 59.472 37.500 0.0 0.0 32.27 4.34 F
1207 1215 4.183865 TCATGTGGATCTAGCTTTCAACG 58.816 43.478 0.0 0.0 0.00 4.10 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1869 1877 1.065418 CCTCCCGCTTTGTCAGGTATT 60.065 52.381 0.00 0.0 0.00 1.89 R
2937 6294 0.030504 CATTTGCAACGTGGTGCTCA 59.969 50.000 11.65 0.0 45.17 4.26 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
712 718 4.563061 GCAGGCAAAACTTCTTCATGAAT 58.437 39.130 8.96 0.0 33.71 2.57
925 933 4.527816 TGCAGCTTTTTGATTATTCAGGGT 59.472 37.500 0.00 0.0 32.27 4.34
1207 1215 4.183865 TCATGTGGATCTAGCTTTCAACG 58.816 43.478 0.00 0.0 0.00 4.10
1316 1324 5.765677 TGGTTCACCTTCATATTTTTCGTGA 59.234 36.000 0.00 0.0 36.82 4.35
1869 1877 0.252761 TCCATGCCATTCTTCGCAGA 59.747 50.000 0.00 0.0 38.64 4.26
2590 5947 2.195096 CCGGTCGCATATGTCGTTTTA 58.805 47.619 15.72 0.0 0.00 1.52
2937 6294 4.337264 AGCAACCTCTTGGGGAAATTAT 57.663 40.909 0.00 0.0 40.03 1.28
2945 6302 3.011144 TCTTGGGGAAATTATGAGCACCA 59.989 43.478 0.00 0.0 0.00 4.17
3040 6397 3.314080 TCGAACCAAAGTAAAAGGCACTG 59.686 43.478 0.00 0.0 40.86 3.66
3048 6405 5.515797 AAGTAAAAGGCACTGAAGTTTCC 57.484 39.130 0.00 0.0 40.86 3.13
3116 6473 4.726825 TCCCACTTAAGATAAGAGCCCAAT 59.273 41.667 10.09 0.0 0.00 3.16
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
806 813 4.054780 TCTCGAAATAAGGTCATTCGGG 57.945 45.455 7.22 4.18 45.82 5.14
925 933 1.177895 TGGAAATTGGCTTCGCTGCA 61.178 50.000 0.00 0.00 34.04 4.41
1207 1215 4.933330 TCTCTCATAATGTGTTCTACGCC 58.067 43.478 0.00 0.00 0.00 5.68
1316 1324 8.231692 ACTGCTATAACTCGCATGATATAGAT 57.768 34.615 0.00 0.00 35.32 1.98
1614 1622 5.793030 TTGATCCATATTGATGCAATGCA 57.207 34.783 11.44 11.44 44.86 3.96
1645 1653 3.452264 TCCATCTCAGAATGTACACCCAG 59.548 47.826 0.00 0.00 37.40 4.45
1869 1877 1.065418 CCTCCCGCTTTGTCAGGTATT 60.065 52.381 0.00 0.00 0.00 1.89
1942 1951 7.601130 ACTTGAACTACGCACATACATTTCTTA 59.399 33.333 0.00 0.00 0.00 2.10
2844 6201 2.333225 CGGCTTCGCTATCGCTCT 59.667 61.111 0.00 0.00 35.26 4.09
2937 6294 0.030504 CATTTGCAACGTGGTGCTCA 59.969 50.000 11.65 0.00 45.17 4.26
3040 6397 7.279758 CCATAAGTCTGAATCTGAGGAAACTTC 59.720 40.741 0.00 0.00 44.43 3.01
3048 6405 6.041511 CACTGACCATAAGTCTGAATCTGAG 58.958 44.000 6.70 0.00 46.46 3.35


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.