Multiple sequence alignment - TraesCS7D01G238900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G238900 chr7D 100.000 2369 0 0 1 2369 203518117 203520485 0 4375
1 TraesCS7D01G238900 chr7B 99.367 2370 14 1 1 2369 644470082 644472451 0 4292
2 TraesCS7D01G238900 chr7A 99.241 2370 17 1 1 2369 60120927 60118558 0 4276
3 TraesCS7D01G238900 chr7A 98.692 2370 29 2 1 2369 63429290 63431658 0 4204
4 TraesCS7D01G238900 chr7A 98.523 2370 32 2 1 2369 211272569 211270202 0 4180
5 TraesCS7D01G238900 chr7A 98.481 2370 35 1 1 2369 46394305 46391936 0 4176
6 TraesCS7D01G238900 chr3A 98.987 2369 23 1 1 2369 633113889 633116256 0 4241
7 TraesCS7D01G238900 chr3A 98.354 2370 38 1 1 2369 51869813 51872182 0 4159
8 TraesCS7D01G238900 chr6B 98.818 2369 27 1 1 2369 306993349 306990982 0 4218
9 TraesCS7D01G238900 chr1B 98.734 2370 29 1 1 2369 638698025 638695656 0 4209


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G238900 chr7D 203518117 203520485 2368 False 4375 4375 100.000 1 2369 1 chr7D.!!$F1 2368
1 TraesCS7D01G238900 chr7B 644470082 644472451 2369 False 4292 4292 99.367 1 2369 1 chr7B.!!$F1 2368
2 TraesCS7D01G238900 chr7A 60118558 60120927 2369 True 4276 4276 99.241 1 2369 1 chr7A.!!$R2 2368
3 TraesCS7D01G238900 chr7A 63429290 63431658 2368 False 4204 4204 98.692 1 2369 1 chr7A.!!$F1 2368
4 TraesCS7D01G238900 chr7A 211270202 211272569 2367 True 4180 4180 98.523 1 2369 1 chr7A.!!$R3 2368
5 TraesCS7D01G238900 chr7A 46391936 46394305 2369 True 4176 4176 98.481 1 2369 1 chr7A.!!$R1 2368
6 TraesCS7D01G238900 chr3A 633113889 633116256 2367 False 4241 4241 98.987 1 2369 1 chr3A.!!$F2 2368
7 TraesCS7D01G238900 chr3A 51869813 51872182 2369 False 4159 4159 98.354 1 2369 1 chr3A.!!$F1 2368
8 TraesCS7D01G238900 chr6B 306990982 306993349 2367 True 4218 4218 98.818 1 2369 1 chr6B.!!$R1 2368
9 TraesCS7D01G238900 chr1B 638695656 638698025 2369 True 4209 4209 98.734 1 2369 1 chr1B.!!$R1 2368

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
453 454 2.422597 TGTATGTGCCAGGAAGTTTCG 58.577 47.619 0.0 0.0 0.0 3.46 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1800 1804 3.837731 CCCTACCCCATTCAACATTTTGT 59.162 43.478 0.0 0.0 34.02 2.83 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
453 454 2.422597 TGTATGTGCCAGGAAGTTTCG 58.577 47.619 0.00 0.0 0.00 3.46
1386 1390 1.234821 GATTTGACTCGGCACAACCA 58.765 50.000 0.00 0.0 39.03 3.67
1800 1804 6.400568 GGGTATACTATACTGCGCCAAAATA 58.599 40.000 4.18 0.0 0.00 1.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
453 454 2.213280 GGAGTAGCCCCCTTCAGAC 58.787 63.158 0.0 0.0 0.00 3.51
1386 1390 7.939039 AGATCATTGGTATTGGATGTATCGTTT 59.061 33.333 0.0 0.0 0.00 3.60
1800 1804 3.837731 CCCTACCCCATTCAACATTTTGT 59.162 43.478 0.0 0.0 34.02 2.83


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.