Multiple sequence alignment - TraesCS7D01G238800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G238800 chr7D 100.000 3215 0 0 1 3215 203515558 203518772 0 5938
1 TraesCS7D01G238800 chr4D 99.409 3215 17 2 1 3215 123299972 123303184 0 5830
2 TraesCS7D01G238800 chr7B 99.036 3216 26 4 1 3215 644467526 644470737 0 5762
3 TraesCS7D01G238800 chr3A 98.694 3215 36 4 1 3215 633111336 633114544 0 5699
4 TraesCS7D01G238800 chr6B 98.601 3217 41 3 1 3215 306995908 306992694 0 5688
5 TraesCS7D01G238800 chr1B 98.416 3219 43 6 1 3215 638700584 638697370 0 5655
6 TraesCS7D01G238800 chr1B 98.072 3215 58 3 1 3215 672479243 672482453 0 5590
7 TraesCS7D01G238800 chr2B 98.165 3215 56 3 2 3215 391112758 391109546 0 5607
8 TraesCS7D01G238800 chr7A 97.856 3218 64 3 1 3215 211275129 211271914 0 5555


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G238800 chr7D 203515558 203518772 3214 False 5938 5938 100.000 1 3215 1 chr7D.!!$F1 3214
1 TraesCS7D01G238800 chr4D 123299972 123303184 3212 False 5830 5830 99.409 1 3215 1 chr4D.!!$F1 3214
2 TraesCS7D01G238800 chr7B 644467526 644470737 3211 False 5762 5762 99.036 1 3215 1 chr7B.!!$F1 3214
3 TraesCS7D01G238800 chr3A 633111336 633114544 3208 False 5699 5699 98.694 1 3215 1 chr3A.!!$F1 3214
4 TraesCS7D01G238800 chr6B 306992694 306995908 3214 True 5688 5688 98.601 1 3215 1 chr6B.!!$R1 3214
5 TraesCS7D01G238800 chr1B 638697370 638700584 3214 True 5655 5655 98.416 1 3215 1 chr1B.!!$R1 3214
6 TraesCS7D01G238800 chr1B 672479243 672482453 3210 False 5590 5590 98.072 1 3215 1 chr1B.!!$F1 3214
7 TraesCS7D01G238800 chr2B 391109546 391112758 3212 True 5607 5607 98.165 2 3215 1 chr2B.!!$R1 3213
8 TraesCS7D01G238800 chr7A 211271914 211275129 3215 True 5555 5555 97.856 1 3215 1 chr7A.!!$R1 3214

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
55 56 1.456287 GCCTCCTCTTGGTTGGTGT 59.544 57.895 0.00 0.0 33.23 4.16 F
863 876 3.243737 ACCAGAAAATGCCTTTCGTTTCC 60.244 43.478 3.48 0.0 46.89 3.13 F
1856 1870 1.404391 TCGAGGTCTCATTAGCCGAAC 59.596 52.381 0.00 0.0 0.00 3.95 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1856 1870 0.967380 GTGGATTGGCCTGGGTCTTG 60.967 60.000 3.32 0.0 37.63 3.02 R
2123 2137 4.326826 CTCTATGCTGTTTGGGAACTCAA 58.673 43.478 0.00 0.0 36.70 3.02 R
3012 3026 2.213280 GGAGTAGCCCCCTTCAGAC 58.787 63.158 0.00 0.0 0.00 3.51 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
55 56 1.456287 GCCTCCTCTTGGTTGGTGT 59.544 57.895 0.00 0.00 33.23 4.16
862 875 3.977427 ACCAGAAAATGCCTTTCGTTTC 58.023 40.909 3.48 0.00 46.89 2.78
863 876 3.243737 ACCAGAAAATGCCTTTCGTTTCC 60.244 43.478 3.48 0.00 46.89 3.13
1719 1732 8.375506 AGTGTCCTGAAGAAGAAATTGTATACA 58.624 33.333 0.08 0.08 0.00 2.29
1856 1870 1.404391 TCGAGGTCTCATTAGCCGAAC 59.596 52.381 0.00 0.00 0.00 3.95
2123 2137 2.702748 AGAAGGTGGTAAGACCCTTGT 58.297 47.619 0.00 0.00 38.68 3.16
2413 2427 7.973048 TGCCTCTTTAGTCTTTCTAATCCTA 57.027 36.000 0.00 0.00 38.27 2.94
2550 2564 6.969473 GCTAAAGCTACCTTGAATCAATCAAC 59.031 38.462 0.00 0.00 39.46 3.18
3012 3026 2.422597 TGTATGTGCCAGGAAGTTTCG 58.577 47.619 0.00 0.00 0.00 3.46
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
55 56 3.147595 CATCACTCTCGGGCCCGA 61.148 66.667 42.62 42.62 46.87 5.14
748 752 2.009774 CGTTGGATGCTCTTTACCCTG 58.990 52.381 0.00 0.00 0.00 4.45
1368 1381 2.119801 TTACCCGTAGACGCTTCTCT 57.880 50.000 0.00 0.00 38.18 3.10
1623 1636 3.076621 CTGACCTGAGCTATGCAACAAA 58.923 45.455 0.00 0.00 0.00 2.83
1856 1870 0.967380 GTGGATTGGCCTGGGTCTTG 60.967 60.000 3.32 0.00 37.63 3.02
2123 2137 4.326826 CTCTATGCTGTTTGGGAACTCAA 58.673 43.478 0.00 0.00 36.70 3.02
3012 3026 2.213280 GGAGTAGCCCCCTTCAGAC 58.787 63.158 0.00 0.00 0.00 3.51


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.