Multiple sequence alignment - TraesCS7D01G238500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G238500 chr7D 100.000 2231 0 0 1 2231 203501673 203503903 0.000000e+00 4120.0
1 TraesCS7D01G238500 chr7D 99.061 2237 14 5 1 2231 382051753 382053988 0.000000e+00 4008.0
2 TraesCS7D01G238500 chr7D 98.927 2237 17 5 1 2231 381925675 381927910 0.000000e+00 3991.0
3 TraesCS7D01G238500 chr7D 98.796 2243 14 7 1 2231 381972096 381969855 0.000000e+00 3980.0
4 TraesCS7D01G238500 chr7D 100.000 54 0 0 2178 2231 626693976 626693923 1.410000e-17 100.0
5 TraesCS7D01G238500 chr6D 98.883 2239 16 7 1 2231 124519196 124521433 0.000000e+00 3988.0
6 TraesCS7D01G238500 chr6D 98.259 2240 29 6 1 2231 458899856 458902094 0.000000e+00 3912.0
7 TraesCS7D01G238500 chr1D 98.123 2238 33 7 1 2231 269408474 269410709 0.000000e+00 3892.0
8 TraesCS7D01G238500 chr7A 98.848 2171 18 3 1 2169 60280987 60283152 0.000000e+00 3864.0
9 TraesCS7D01G238500 chr7B 98.803 2172 18 4 1 2169 742991119 742993285 0.000000e+00 3860.0
10 TraesCS7D01G238500 chr5A 98.756 2170 26 1 1 2169 238821134 238818965 0.000000e+00 3856.0
11 TraesCS7D01G238500 chr6B 100.000 54 0 0 2178 2231 388152976 388152923 1.410000e-17 100.0
12 TraesCS7D01G238500 chr5B 90.411 73 5 2 2159 2231 679662679 679662749 6.560000e-16 95.3


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G238500 chr7D 203501673 203503903 2230 False 4120 4120 100.000 1 2231 1 chr7D.!!$F1 2230
1 TraesCS7D01G238500 chr7D 382051753 382053988 2235 False 4008 4008 99.061 1 2231 1 chr7D.!!$F3 2230
2 TraesCS7D01G238500 chr7D 381925675 381927910 2235 False 3991 3991 98.927 1 2231 1 chr7D.!!$F2 2230
3 TraesCS7D01G238500 chr7D 381969855 381972096 2241 True 3980 3980 98.796 1 2231 1 chr7D.!!$R1 2230
4 TraesCS7D01G238500 chr6D 124519196 124521433 2237 False 3988 3988 98.883 1 2231 1 chr6D.!!$F1 2230
5 TraesCS7D01G238500 chr6D 458899856 458902094 2238 False 3912 3912 98.259 1 2231 1 chr6D.!!$F2 2230
6 TraesCS7D01G238500 chr1D 269408474 269410709 2235 False 3892 3892 98.123 1 2231 1 chr1D.!!$F1 2230
7 TraesCS7D01G238500 chr7A 60280987 60283152 2165 False 3864 3864 98.848 1 2169 1 chr7A.!!$F1 2168
8 TraesCS7D01G238500 chr7B 742991119 742993285 2166 False 3860 3860 98.803 1 2169 1 chr7B.!!$F1 2168
9 TraesCS7D01G238500 chr5A 238818965 238821134 2169 True 3856 3856 98.756 1 2169 1 chr5A.!!$R1 2168

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
108 109 6.068616 AGGTGTAATAGGACTCCCAGTTACTA 60.069 42.308 12.52 0.0 36.42 1.82 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1677 1700 2.983229 TCGGAGACTAGACTAGCGTTT 58.017 47.619 9.52 0.0 0.0 3.6 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
108 109 6.068616 AGGTGTAATAGGACTCCCAGTTACTA 60.069 42.308 12.52 0.00 36.42 1.82
1106 1127 1.061546 AAACGCTCCTAACCCCTTCA 58.938 50.000 0.00 0.00 0.00 3.02
1456 1478 6.888105 TCAAATGGCACTCAGTTCATATCTA 58.112 36.000 0.00 0.00 30.52 1.98
1677 1700 2.368875 GTCTGTCTCCTTTGTCCTTCCA 59.631 50.000 0.00 0.00 0.00 3.53
2166 2189 2.303175 ACTCGAGACCCTATTGAGCTC 58.697 52.381 21.68 6.82 0.00 4.09
2167 2190 2.092103 ACTCGAGACCCTATTGAGCTCT 60.092 50.000 21.68 0.00 0.00 4.09
2169 2192 2.690497 TCGAGACCCTATTGAGCTCTTG 59.310 50.000 16.19 2.29 0.00 3.02
2172 2195 2.433970 AGACCCTATTGAGCTCTTGAGC 59.566 50.000 16.19 14.16 0.00 4.26
2173 2196 1.137872 ACCCTATTGAGCTCTTGAGCG 59.862 52.381 16.19 4.10 40.27 5.03
2176 2204 2.035193 CCTATTGAGCTCTTGAGCGCTA 59.965 50.000 22.60 17.33 36.07 4.26
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
546 547 9.492973 AATCAAAGGTTTCATGAAATCGAAATT 57.507 25.926 23.05 17.36 36.56 1.82
1106 1127 4.733165 TCACTTACTATACACGGCCCTAT 58.267 43.478 0.00 0.00 0.00 2.57
1456 1478 6.036083 CCTTGTCAATGATCGAACGAACTTAT 59.964 38.462 0.12 0.00 0.00 1.73
1677 1700 2.983229 TCGGAGACTAGACTAGCGTTT 58.017 47.619 9.52 0.00 0.00 3.60
2166 2189 4.989797 AGATCATCAAAGATAGCGCTCAAG 59.010 41.667 16.34 0.00 0.00 3.02
2167 2190 4.953667 AGATCATCAAAGATAGCGCTCAA 58.046 39.130 16.34 0.00 0.00 3.02
2169 2192 4.987285 TGAAGATCATCAAAGATAGCGCTC 59.013 41.667 16.34 0.00 0.00 5.03
2172 2195 6.036408 TGTGTTGAAGATCATCAAAGATAGCG 59.964 38.462 14.54 0.00 40.76 4.26
2173 2196 7.312657 TGTGTTGAAGATCATCAAAGATAGC 57.687 36.000 14.54 2.89 40.76 2.97
2176 2204 9.848710 ATAGATGTGTTGAAGATCATCAAAGAT 57.151 29.630 14.54 9.26 40.76 2.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.