Multiple sequence alignment - TraesCS7D01G238400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G238400 chr7D 100.000 2718 0 0 1 2718 203503471 203500754 0 5020
1 TraesCS7D01G238400 chr7D 99.411 2718 16 0 1 2718 382053551 382050834 0 4931
2 TraesCS7D01G238400 chr7D 99.337 2715 18 0 4 2718 381927470 381924756 0 4915
3 TraesCS7D01G238400 chr7D 99.082 2724 16 3 1 2718 381970292 381973012 0 4883
4 TraesCS7D01G238400 chr5A 99.449 2720 13 1 1 2718 19245369 19248088 0 4939
5 TraesCS7D01G238400 chr6D 99.154 2720 21 2 1 2718 124520996 124518277 0 4894
6 TraesCS7D01G238400 chr7B 98.934 2720 22 2 1 2718 716875312 716878026 0 4855
7 TraesCS7D01G238400 chr7B 98.824 2720 25 3 1 2718 742992914 742990200 0 4839
8 TraesCS7D01G238400 chr7A 98.897 2719 24 2 1 2718 60282781 60280068 0 4850
9 TraesCS7D01G238400 chr1A 98.897 2719 24 2 1 2718 498687759 498690472 0 4850


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G238400 chr7D 203500754 203503471 2717 True 5020 5020 100.000 1 2718 1 chr7D.!!$R1 2717
1 TraesCS7D01G238400 chr7D 382050834 382053551 2717 True 4931 4931 99.411 1 2718 1 chr7D.!!$R3 2717
2 TraesCS7D01G238400 chr7D 381924756 381927470 2714 True 4915 4915 99.337 4 2718 1 chr7D.!!$R2 2714
3 TraesCS7D01G238400 chr7D 381970292 381973012 2720 False 4883 4883 99.082 1 2718 1 chr7D.!!$F1 2717
4 TraesCS7D01G238400 chr5A 19245369 19248088 2719 False 4939 4939 99.449 1 2718 1 chr5A.!!$F1 2717
5 TraesCS7D01G238400 chr6D 124518277 124520996 2719 True 4894 4894 99.154 1 2718 1 chr6D.!!$R1 2717
6 TraesCS7D01G238400 chr7B 716875312 716878026 2714 False 4855 4855 98.934 1 2718 1 chr7B.!!$F1 2717
7 TraesCS7D01G238400 chr7B 742990200 742992914 2714 True 4839 4839 98.824 1 2718 1 chr7B.!!$R1 2717
8 TraesCS7D01G238400 chr7A 60280068 60282781 2713 True 4850 4850 98.897 1 2718 1 chr7A.!!$R1 2717
9 TraesCS7D01G238400 chr1A 498687759 498690472 2713 False 4850 4850 98.897 1 2718 1 chr1A.!!$F1 2717

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
121 122 2.983229 TCGGAGACTAGACTAGCGTTT 58.017 47.619 9.52 0.0 0.0 3.6 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1876 1891 0.598065 GAAGGCAGTTTTCCGTGCAT 59.402 50.0 0.0 0.0 41.75 3.96 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
121 122 2.983229 TCGGAGACTAGACTAGCGTTT 58.017 47.619 9.52 0.00 0.00 3.60
342 345 6.036083 CCTTGTCAATGATCGAACGAACTTAT 59.964 38.462 0.12 0.00 0.00 1.73
692 696 4.733165 TCACTTACTATACACGGCCCTAT 58.267 43.478 0.00 0.00 0.00 2.57
1252 1267 9.492973 AATCAAAGGTTTCATGAAATCGAAATT 57.507 25.926 23.05 17.36 36.56 1.82
1852 1867 2.093869 GCATTCCCATCTGTGTTGCAAT 60.094 45.455 0.59 0.00 0.00 3.56
1876 1891 0.673333 TCGGTAAGCTACGTGTCCGA 60.673 55.000 0.00 5.95 43.52 4.55
1967 1982 2.238144 ACGCTAGTCACTACTCCCACTA 59.762 50.000 0.00 0.00 37.15 2.74
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
121 122 2.368875 GTCTGTCTCCTTTGTCCTTCCA 59.631 50.000 0.00 0.0 0.00 3.53
342 345 6.888105 TCAAATGGCACTCAGTTCATATCTA 58.112 36.000 0.00 0.0 30.52 1.98
692 696 1.061546 AAACGCTCCTAACCCCTTCA 58.938 50.000 0.00 0.0 0.00 3.02
1690 1705 6.068616 AGGTGTAATAGGACTCCCAGTTACTA 60.069 42.308 12.52 0.0 36.42 1.82
1852 1867 3.504863 GACACGTAGCTTACCGAATCAA 58.495 45.455 0.00 0.0 0.00 2.57
1876 1891 0.598065 GAAGGCAGTTTTCCGTGCAT 59.402 50.000 0.00 0.0 41.75 3.96


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.