Multiple sequence alignment - TraesCS7D01G223600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G223600 chr7D 100.000 2986 0 0 1 2986 184519266 184516281 0.000000e+00 5515
1 TraesCS7D01G223600 chr4D 98.999 2498 25 0 1 2498 85731745 85734242 0.000000e+00 4475
2 TraesCS7D01G223600 chr6D 98.799 2498 14 1 1 2498 460763885 460766366 0.000000e+00 4433
3 TraesCS7D01G223600 chr6D 92.540 1126 81 3 39 1162 19721043 19722167 0.000000e+00 1611
4 TraesCS7D01G223600 chr5B 97.083 2503 45 4 1 2498 485818102 485815623 0.000000e+00 4193
5 TraesCS7D01G223600 chr3D 94.602 2501 107 18 1 2497 363068256 363070732 0.000000e+00 3845
6 TraesCS7D01G223600 chr3D 99.370 2062 12 1 1 2062 375237272 375235212 0.000000e+00 3735
7 TraesCS7D01G223600 chr3D 94.533 439 3 1 2060 2498 375225619 375225202 0.000000e+00 658
8 TraesCS7D01G223600 chr3D 93.785 177 10 1 2322 2497 54627936 54627760 6.350000e-67 265
9 TraesCS7D01G223600 chr7B 93.557 2499 128 20 1 2497 552549936 552552403 0.000000e+00 3692
10 TraesCS7D01G223600 chr7B 93.129 1470 77 13 1028 2497 173303677 173302232 0.000000e+00 2134
11 TraesCS7D01G223600 chr1A 92.830 2092 119 20 295 2382 98291582 98289518 0.000000e+00 3003
12 TraesCS7D01G223600 chr3A 96.700 1788 31 4 716 2497 701761531 701759766 0.000000e+00 2950
13 TraesCS7D01G223600 chr7A 95.379 1450 65 2 1 1449 383417560 383419008 0.000000e+00 2305
14 TraesCS7D01G223600 chr7A 94.580 369 19 1 2619 2986 185979216 185979584 1.200000e-158 569
15 TraesCS7D01G223600 chr7A 91.589 107 3 1 2499 2599 185979057 185979163 3.100000e-30 143
16 TraesCS7D01G223600 chr1D 99.126 1030 8 1 1469 2498 267389415 267388387 0.000000e+00 1851
17 TraesCS7D01G223600 chr1B 90.191 836 55 15 1661 2496 645734905 645735713 0.000000e+00 1064


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G223600 chr7D 184516281 184519266 2985 True 5515 5515 100.0000 1 2986 1 chr7D.!!$R1 2985
1 TraesCS7D01G223600 chr4D 85731745 85734242 2497 False 4475 4475 98.9990 1 2498 1 chr4D.!!$F1 2497
2 TraesCS7D01G223600 chr6D 460763885 460766366 2481 False 4433 4433 98.7990 1 2498 1 chr6D.!!$F2 2497
3 TraesCS7D01G223600 chr6D 19721043 19722167 1124 False 1611 1611 92.5400 39 1162 1 chr6D.!!$F1 1123
4 TraesCS7D01G223600 chr5B 485815623 485818102 2479 True 4193 4193 97.0830 1 2498 1 chr5B.!!$R1 2497
5 TraesCS7D01G223600 chr3D 363068256 363070732 2476 False 3845 3845 94.6020 1 2497 1 chr3D.!!$F1 2496
6 TraesCS7D01G223600 chr3D 375235212 375237272 2060 True 3735 3735 99.3700 1 2062 1 chr3D.!!$R3 2061
7 TraesCS7D01G223600 chr7B 552549936 552552403 2467 False 3692 3692 93.5570 1 2497 1 chr7B.!!$F1 2496
8 TraesCS7D01G223600 chr7B 173302232 173303677 1445 True 2134 2134 93.1290 1028 2497 1 chr7B.!!$R1 1469
9 TraesCS7D01G223600 chr1A 98289518 98291582 2064 True 3003 3003 92.8300 295 2382 1 chr1A.!!$R1 2087
10 TraesCS7D01G223600 chr3A 701759766 701761531 1765 True 2950 2950 96.7000 716 2497 1 chr3A.!!$R1 1781
11 TraesCS7D01G223600 chr7A 383417560 383419008 1448 False 2305 2305 95.3790 1 1449 1 chr7A.!!$F1 1448
12 TraesCS7D01G223600 chr7A 185979057 185979584 527 False 356 569 93.0845 2499 2986 2 chr7A.!!$F2 487
13 TraesCS7D01G223600 chr1D 267388387 267389415 1028 True 1851 1851 99.1260 1469 2498 1 chr1D.!!$R1 1029
14 TraesCS7D01G223600 chr1B 645734905 645735713 808 False 1064 1064 90.1910 1661 2496 1 chr1B.!!$F1 835

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1655 1677 6.660521 ACACCAATAATGAAAGCTCATCTTCA 59.339 34.615 1.21 1.21 41.66 3.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2645 2733 0.183492 TAAGTGCATCCATGGCCTCC 59.817 55.0 6.96 0.0 0.0 4.3 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1655 1677 6.660521 ACACCAATAATGAAAGCTCATCTTCA 59.339 34.615 1.21 1.21 41.66 3.02
1883 1906 1.039068 CCACCAATGAACAAGTGGCA 58.961 50.000 8.35 0.00 43.02 4.92
1932 1955 2.484264 GCTATTCAAGAGTTTGTGCGGT 59.516 45.455 0.00 0.00 35.73 5.68
2103 2127 7.679783 TGATGTCAGAGAGTTTTTCATTCCTA 58.320 34.615 0.00 0.00 0.00 2.94
2517 2566 3.514645 CTTGGAATGCAATGTTAGTGGC 58.485 45.455 0.00 0.00 0.00 5.01
2617 2685 1.654743 CGTAGAGAACGCGCCTAGC 60.655 63.158 5.73 0.00 46.10 3.42
2642 2730 7.284351 CGGAAGAGACGAGCATATAAATTTTC 58.716 38.462 0.00 0.00 0.00 2.29
2643 2731 7.284351 GGAAGAGACGAGCATATAAATTTTCG 58.716 38.462 0.00 0.76 0.00 3.46
2645 2733 7.630470 AGAGACGAGCATATAAATTTTCGAG 57.370 36.000 13.10 0.00 32.81 4.04
2646 2734 6.642950 AGAGACGAGCATATAAATTTTCGAGG 59.357 38.462 13.10 0.00 32.81 4.63
2647 2735 6.513180 AGACGAGCATATAAATTTTCGAGGA 58.487 36.000 13.10 0.00 32.81 3.71
2745 2833 1.063190 TGATAGGACGGGAGACATGGT 60.063 52.381 0.00 0.00 0.00 3.55
2792 2880 8.674263 ATTATTCTCAGATCAGTTGGATGAAC 57.326 34.615 0.00 0.00 36.00 3.18
2822 2911 7.144661 AGTTTTTCATATCAATGCGAACAACA 58.855 30.769 0.00 0.00 32.76 3.33
2834 2923 3.064271 TGCGAACAACAAGGTTTGAGTAC 59.936 43.478 0.00 0.00 34.67 2.73
2844 2933 9.233232 CAACAAGGTTTGAGTACATAAGTTTTC 57.767 33.333 0.00 0.00 0.00 2.29
2924 3013 6.286240 ACTACACAACTCTTGCATGATAGA 57.714 37.500 2.33 0.00 0.00 1.98
2939 3028 5.295950 CATGATAGAACAGGAGACATGGTC 58.704 45.833 0.00 0.00 34.45 4.02
2947 3036 0.673644 GGAGACATGGTCGGTTGTGG 60.674 60.000 0.00 0.00 37.67 4.17
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
367 377 2.555547 GCTGCATAACCCGCATCCC 61.556 63.158 0.00 0.00 39.02 3.85
718 730 4.131596 CTCCCTTTGTTCCTCACGTAAAA 58.868 43.478 0.00 0.00 0.00 1.52
1655 1677 1.192146 TGCCACCTCTAGGACGCTTT 61.192 55.000 2.23 0.00 38.94 3.51
1883 1906 0.259938 GCCTCCCCTTCAACATGGAT 59.740 55.000 0.00 0.00 0.00 3.41
1932 1955 0.981183 AAGTTATCACGGACCCAGCA 59.019 50.000 0.00 0.00 0.00 4.41
2501 2550 2.158559 TGTCGCCACTAACATTGCATT 58.841 42.857 0.00 0.00 0.00 3.56
2504 2553 1.724654 CGTTGTCGCCACTAACATTGC 60.725 52.381 0.00 0.00 0.00 3.56
2617 2685 6.771188 AAATTTATATGCTCGTCTCTTCCG 57.229 37.500 0.00 0.00 0.00 4.30
2642 2730 2.281345 GCATCCATGGCCTCCTCG 60.281 66.667 6.96 0.00 0.00 4.63
2643 2731 1.527844 GTGCATCCATGGCCTCCTC 60.528 63.158 6.96 0.00 0.00 3.71
2645 2733 0.183492 TAAGTGCATCCATGGCCTCC 59.817 55.000 6.96 0.00 0.00 4.30
2646 2734 1.952296 CTTAAGTGCATCCATGGCCTC 59.048 52.381 6.96 0.00 0.00 4.70
2647 2735 1.285962 ACTTAAGTGCATCCATGGCCT 59.714 47.619 7.48 0.00 0.00 5.19
2703 2791 7.692460 TCATGCATCTTGTTTCAAGAGTTAT 57.308 32.000 15.59 8.16 0.00 1.89
2713 2801 3.879295 CCGTCCTATCATGCATCTTGTTT 59.121 43.478 0.00 0.00 0.00 2.83
2770 2858 5.114780 CGTTCATCCAACTGATCTGAGAAT 58.885 41.667 6.60 0.00 32.09 2.40
2777 2865 3.189287 ACTTTGCGTTCATCCAACTGATC 59.811 43.478 0.00 0.00 32.09 2.92
2787 2875 8.649841 CATTGATATGAAAAACTTTGCGTTCAT 58.350 29.630 0.00 0.00 42.05 2.57
2792 2880 5.474545 CGCATTGATATGAAAAACTTTGCG 58.525 37.500 4.41 4.41 42.34 4.85
2822 2911 8.621286 CACAGAAAACTTATGTACTCAAACCTT 58.379 33.333 0.00 0.00 0.00 3.50
2834 2923 4.142315 CCATGGCCTCACAGAAAACTTATG 60.142 45.833 3.32 0.00 0.00 1.90
2924 3013 1.056660 AACCGACCATGTCTCCTGTT 58.943 50.000 0.00 0.00 0.00 3.16
2947 3036 0.810426 GAAGAATTCTCCGTCGCCCC 60.810 60.000 8.78 0.00 43.23 5.80


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.