Multiple sequence alignment - TraesCS7D01G201900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G201900 chr7D 100.000 2473 0 0 1 2473 160707167 160704695 0.000000e+00 4567.0
1 TraesCS7D01G201900 chr7D 96.910 2492 55 5 1 2473 160690954 160688466 0.000000e+00 4156.0
2 TraesCS7D01G201900 chr7D 96.709 2492 61 4 1 2473 160666495 160664006 0.000000e+00 4128.0
3 TraesCS7D01G201900 chr7D 94.299 1877 74 6 1 1847 536395118 536396991 0.000000e+00 2843.0
4 TraesCS7D01G201900 chr7D 96.391 1635 55 3 1 1633 548271627 548269995 0.000000e+00 2689.0
5 TraesCS7D01G201900 chr7D 95.041 121 3 2 1727 1846 37281571 37281689 1.170000e-43 187.0
6 TraesCS7D01G201900 chr7D 91.057 123 7 3 1727 1848 75161727 75161846 1.970000e-36 163.0
7 TraesCS7D01G201900 chr5D 95.220 1862 68 7 1 1846 455877529 455879385 0.000000e+00 2926.0
8 TraesCS7D01G201900 chr2D 93.757 1874 71 8 1 1854 147957630 147959477 0.000000e+00 2771.0
9 TraesCS7D01G201900 chr2D 94.342 1573 56 4 307 1847 56318390 56319961 0.000000e+00 2381.0
10 TraesCS7D01G201900 chr2D 89.435 407 29 1 1455 1847 588795300 588794894 3.670000e-138 501.0
11 TraesCS7D01G201900 chr6D 96.516 1636 54 1 1 1633 413389102 413390737 0.000000e+00 2702.0
12 TraesCS7D01G201900 chr5A 94.266 1744 91 7 1 1744 544021407 544023141 0.000000e+00 2658.0
13 TraesCS7D01G201900 chr7A 93.754 1633 100 2 1 1633 154784904 154786534 0.000000e+00 2449.0
14 TraesCS7D01G201900 chr7A 95.370 324 12 1 1841 2161 161994726 161994403 1.700000e-141 512.0
15 TraesCS7D01G201900 chr7A 87.409 413 35 3 1457 1855 23698785 23699194 2.240000e-125 459.0
16 TraesCS7D01G201900 chr7A 89.067 375 24 2 1496 1854 8628521 8628148 1.350000e-122 449.0
17 TraesCS7D01G201900 chr7A 91.346 312 27 0 2162 2473 91533025 91533336 6.320000e-116 427.0
18 TraesCS7D01G201900 chr4A 91.695 1770 118 19 57 1820 231097359 231095613 0.000000e+00 2427.0
19 TraesCS7D01G201900 chr3D 94.074 1603 60 5 283 1851 73870427 73872028 0.000000e+00 2401.0
20 TraesCS7D01G201900 chr3D 96.256 1202 45 0 1 1202 101852484 101853685 0.000000e+00 1971.0
21 TraesCS7D01G201900 chr3D 90.123 405 27 7 1455 1847 560126007 560126410 4.720000e-142 514.0
22 TraesCS7D01G201900 chr3D 85.888 411 37 5 1457 1854 581558832 581559234 3.800000e-113 418.0
23 TraesCS7D01G201900 chr2A 91.667 312 26 0 2162 2473 67979328 67979017 1.360000e-117 433.0
24 TraesCS7D01G201900 chr2A 90.566 53 4 1 1687 1739 202224480 202224429 4.410000e-08 69.4
25 TraesCS7D01G201900 chr3B 91.026 312 28 0 2162 2473 44665361 44665672 2.940000e-114 422.0
26 TraesCS7D01G201900 chr3B 89.744 312 32 0 2162 2473 163684447 163684758 1.380000e-107 399.0
27 TraesCS7D01G201900 chr3B 92.063 126 7 3 1733 1856 615471393 615471269 9.090000e-40 174.0
28 TraesCS7D01G201900 chrUn 91.026 312 25 2 2162 2473 339520009 339519701 3.800000e-113 418.0
29 TraesCS7D01G201900 chr2B 90.415 313 25 1 2161 2473 777443399 777443706 8.230000e-110 407.0
30 TraesCS7D01G201900 chr4D 89.776 313 30 2 2162 2473 353863145 353863456 1.380000e-107 399.0
31 TraesCS7D01G201900 chr4D 93.388 121 5 2 1727 1847 484449478 484449595 2.530000e-40 176.0
32 TraesCS7D01G201900 chr7B 89.231 325 20 5 1841 2161 122428009 122427696 2.310000e-105 392.0
33 TraesCS7D01G201900 chr3A 96.250 80 3 0 1660 1739 465841301 465841380 5.550000e-27 132.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G201900 chr7D 160704695 160707167 2472 True 4567 4567 100.000 1 2473 1 chr7D.!!$R3 2472
1 TraesCS7D01G201900 chr7D 160688466 160690954 2488 True 4156 4156 96.910 1 2473 1 chr7D.!!$R2 2472
2 TraesCS7D01G201900 chr7D 160664006 160666495 2489 True 4128 4128 96.709 1 2473 1 chr7D.!!$R1 2472
3 TraesCS7D01G201900 chr7D 536395118 536396991 1873 False 2843 2843 94.299 1 1847 1 chr7D.!!$F3 1846
4 TraesCS7D01G201900 chr7D 548269995 548271627 1632 True 2689 2689 96.391 1 1633 1 chr7D.!!$R4 1632
5 TraesCS7D01G201900 chr5D 455877529 455879385 1856 False 2926 2926 95.220 1 1846 1 chr5D.!!$F1 1845
6 TraesCS7D01G201900 chr2D 147957630 147959477 1847 False 2771 2771 93.757 1 1854 1 chr2D.!!$F2 1853
7 TraesCS7D01G201900 chr2D 56318390 56319961 1571 False 2381 2381 94.342 307 1847 1 chr2D.!!$F1 1540
8 TraesCS7D01G201900 chr6D 413389102 413390737 1635 False 2702 2702 96.516 1 1633 1 chr6D.!!$F1 1632
9 TraesCS7D01G201900 chr5A 544021407 544023141 1734 False 2658 2658 94.266 1 1744 1 chr5A.!!$F1 1743
10 TraesCS7D01G201900 chr7A 154784904 154786534 1630 False 2449 2449 93.754 1 1633 1 chr7A.!!$F3 1632
11 TraesCS7D01G201900 chr4A 231095613 231097359 1746 True 2427 2427 91.695 57 1820 1 chr4A.!!$R1 1763
12 TraesCS7D01G201900 chr3D 73870427 73872028 1601 False 2401 2401 94.074 283 1851 1 chr3D.!!$F1 1568
13 TraesCS7D01G201900 chr3D 101852484 101853685 1201 False 1971 1971 96.256 1 1202 1 chr3D.!!$F2 1201

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
504 507 0.263172 TTGCCTTTCCCCTGTTTCCA 59.737 50.0 0.0 0.0 0.0 3.53 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1717 1868 0.041238 TTCGTCTCTCCTCCCACCAT 59.959 55.0 0.0 0.0 0.0 3.55 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
85 86 1.755008 GCTACAGAGTCGGGCTCCT 60.755 63.158 5.89 0.00 45.21 3.69
259 261 3.717294 GGCCACCATGACCGACCT 61.717 66.667 0.00 0.00 0.00 3.85
371 373 4.552365 CAGCACCCCCGCATCGAT 62.552 66.667 0.00 0.00 0.00 3.59
402 404 0.610232 CTTCCTCAACCTTGGGCCAG 60.610 60.000 6.23 0.00 0.00 4.85
419 421 3.788766 GCGCGACATTGCCGTTCT 61.789 61.111 12.10 0.00 0.00 3.01
422 424 0.650512 CGCGACATTGCCGTTCTATT 59.349 50.000 0.00 0.00 0.00 1.73
452 454 1.333636 CGAGCTCCCATGTCTTCCCT 61.334 60.000 8.47 0.00 0.00 4.20
464 466 0.399376 TCTTCCCTTAGGGCGCCATA 60.399 55.000 30.85 24.85 43.94 2.74
504 507 0.263172 TTGCCTTTCCCCTGTTTCCA 59.737 50.000 0.00 0.00 0.00 3.53
766 805 4.248842 CGACACACACCCTGGCCA 62.249 66.667 4.71 4.71 0.00 5.36
926 965 2.805313 ATCTCTGCCCTCCACCGTCA 62.805 60.000 0.00 0.00 0.00 4.35
1032 1079 2.560119 GCCGTGGACAAATGTGGCA 61.560 57.895 7.52 0.00 42.03 4.92
1099 1147 3.086600 GAGGCAGGAGGTCTGGGG 61.087 72.222 0.00 0.00 43.54 4.96
1254 1309 4.464947 GAGGGGTGATTTCCTTCAATAGG 58.535 47.826 0.00 0.00 46.27 2.57
1348 1406 5.976458 TGATTTCTATGCAAATGGGGTTTC 58.024 37.500 0.00 0.00 0.00 2.78
1574 1632 8.359642 TCCTGAAAATCTGTTATTTGTTTCCTG 58.640 33.333 0.00 0.00 0.00 3.86
1634 1692 8.506168 TTGCATAATTTAAGGAAGTTCGATCT 57.494 30.769 0.00 0.00 0.00 2.75
1642 1700 7.979444 TTAAGGAAGTTCGATCTGTGATTTT 57.021 32.000 0.00 0.00 0.00 1.82
1702 1853 6.318900 GTGGAGAGAAAAATAAACCGATGGAT 59.681 38.462 0.00 0.00 0.00 3.41
1717 1868 2.372688 GATCAGGGTGGGAGGGGA 59.627 66.667 0.00 0.00 0.00 4.81
1746 1911 4.492611 GAGGAGAGACGAAAATAAACCGT 58.507 43.478 0.00 0.00 39.41 4.83
1831 2008 3.444388 GGAGACTATTCACCAACTCGTCT 59.556 47.826 0.00 0.00 32.87 4.18
2022 2199 2.985896 TGCAACTTAAATCTAGCGCCT 58.014 42.857 2.29 0.00 0.00 5.52
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
371 373 3.282745 GAGGAAGACGGCAGCGACA 62.283 63.158 0.00 0.00 0.00 4.35
402 404 1.762222 ATAGAACGGCAATGTCGCGC 61.762 55.000 7.32 0.00 32.11 6.86
452 454 1.827394 GGTGTCTATGGCGCCCTAA 59.173 57.895 26.77 5.45 0.00 2.69
464 466 0.689080 AGGAGATCATGGCGGTGTCT 60.689 55.000 0.00 0.00 0.00 3.41
1032 1079 7.239438 TCTCGTACTCCATTAATAATCCCTCT 58.761 38.462 0.00 0.00 0.00 3.69
1099 1147 4.626081 ACAGCCAGGTGACACCGC 62.626 66.667 18.93 16.60 44.90 5.68
1254 1309 9.705290 ACAACCAATATTTTCTATGTTTTCCAC 57.295 29.630 0.00 0.00 0.00 4.02
1348 1406 7.072177 ACTGATATCACGTTACCAAACAATG 57.928 36.000 0.00 0.00 35.16 2.82
1574 1632 9.710900 ATTCCTTTTATTGGTTCAATTTGTCTC 57.289 29.630 0.00 0.00 35.54 3.36
1642 1700 7.933033 ACAACCAGAACTTTCCTAACGTATAAA 59.067 33.333 0.00 0.00 0.00 1.40
1702 1853 2.042762 CATCCCCTCCCACCCTGA 59.957 66.667 0.00 0.00 0.00 3.86
1717 1868 0.041238 TTCGTCTCTCCTCCCACCAT 59.959 55.000 0.00 0.00 0.00 3.55
1746 1911 4.675303 CCCTCCCACCCTGGTCCA 62.675 72.222 0.00 0.00 35.17 4.02
1831 2008 9.760926 ACCTATGATGCATCTCTACTTCTAATA 57.239 33.333 26.32 11.09 0.00 0.98
2022 2199 2.301870 ACTCCCTCATGCTTGTTCGTTA 59.698 45.455 0.00 0.00 0.00 3.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.