Multiple sequence alignment - TraesCS7D01G175200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G175200 chr7D 100.000 3662 0 0 1 3662 127416964 127413303 0.000000e+00 6763.0
1 TraesCS7D01G175200 chr7D 96.862 3665 111 4 1 3662 58108629 58112292 0.000000e+00 6128.0
2 TraesCS7D01G175200 chr1D 96.999 3665 106 4 1 3662 71308016 71304353 0.000000e+00 6156.0
3 TraesCS7D01G175200 chr2D 96.780 3665 104 6 1 3662 639464302 639467955 0.000000e+00 6102.0
4 TraesCS7D01G175200 chr2D 96.480 3665 120 5 1 3662 345274982 345271324 0.000000e+00 6045.0
5 TraesCS7D01G175200 chr2A 93.895 3669 202 10 1 3662 32135383 32131730 0.000000e+00 5515.0
6 TraesCS7D01G175200 chr2A 83.750 80 13 0 1001 1080 80539924 80539845 3.920000e-10 76.8
7 TraesCS7D01G175200 chr1A 94.058 3164 179 7 1 3159 546526287 546523128 0.000000e+00 4793.0
8 TraesCS7D01G175200 chr1A 78.618 1085 197 28 194 1261 10588701 10587635 0.000000e+00 686.0
9 TraesCS7D01G175200 chr5D 98.410 2076 31 2 1 2075 42224958 42222884 0.000000e+00 3650.0
10 TraesCS7D01G175200 chr5D 95.885 1458 57 3 2207 3662 42222895 42221439 0.000000e+00 2357.0
11 TraesCS7D01G175200 chr4D 76.833 2659 527 66 1 2615 508533515 508530902 0.000000e+00 1415.0
12 TraesCS7D01G175200 chr6B 82.353 629 91 16 1 614 669533015 669533638 2.500000e-146 529.0
13 TraesCS7D01G175200 chr5A 81.319 637 91 19 1 614 611016246 611015615 3.290000e-135 492.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G175200 chr7D 127413303 127416964 3661 True 6763.0 6763 100.0000 1 3662 1 chr7D.!!$R1 3661
1 TraesCS7D01G175200 chr7D 58108629 58112292 3663 False 6128.0 6128 96.8620 1 3662 1 chr7D.!!$F1 3661
2 TraesCS7D01G175200 chr1D 71304353 71308016 3663 True 6156.0 6156 96.9990 1 3662 1 chr1D.!!$R1 3661
3 TraesCS7D01G175200 chr2D 639464302 639467955 3653 False 6102.0 6102 96.7800 1 3662 1 chr2D.!!$F1 3661
4 TraesCS7D01G175200 chr2D 345271324 345274982 3658 True 6045.0 6045 96.4800 1 3662 1 chr2D.!!$R1 3661
5 TraesCS7D01G175200 chr2A 32131730 32135383 3653 True 5515.0 5515 93.8950 1 3662 1 chr2A.!!$R1 3661
6 TraesCS7D01G175200 chr1A 546523128 546526287 3159 True 4793.0 4793 94.0580 1 3159 1 chr1A.!!$R2 3158
7 TraesCS7D01G175200 chr1A 10587635 10588701 1066 True 686.0 686 78.6180 194 1261 1 chr1A.!!$R1 1067
8 TraesCS7D01G175200 chr5D 42221439 42224958 3519 True 3003.5 3650 97.1475 1 3662 2 chr5D.!!$R1 3661
9 TraesCS7D01G175200 chr4D 508530902 508533515 2613 True 1415.0 1415 76.8330 1 2615 1 chr4D.!!$R1 2614
10 TraesCS7D01G175200 chr6B 669533015 669533638 623 False 529.0 529 82.3530 1 614 1 chr6B.!!$F1 613
11 TraesCS7D01G175200 chr5A 611015615 611016246 631 True 492.0 492 81.3190 1 614 1 chr5A.!!$R1 613

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
659 684 1.357137 TATGGTCAACTGGTGCCAGA 58.643 50.0 23.55 7.08 46.30 3.86 F
2381 2469 0.966179 CCATACGATGATCGGGGTGA 59.034 55.0 19.82 0.00 45.59 4.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2484 2572 1.202592 TGCGGACAAGTTGTGCTCTTA 60.203 47.619 22.93 5.99 36.50 2.10 R
3206 3296 1.272781 CGACCGAAGCAGATCTTGAC 58.727 55.000 0.00 0.00 34.56 3.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
260 277 1.546029 CCTGCTATGATACGGCTGCTA 59.454 52.381 0.00 0.00 0.00 3.49
316 333 2.373169 ACAGGACAGATCACAACCATGT 59.627 45.455 0.00 0.00 41.61 3.21
659 684 1.357137 TATGGTCAACTGGTGCCAGA 58.643 50.000 23.55 7.08 46.30 3.86
1165 1247 4.049186 ACACATGTTGACAGTAGACGAAC 58.951 43.478 0.00 0.00 0.00 3.95
1209 1291 5.823209 TGATTGAAACATATGGTCTGCAG 57.177 39.130 7.63 7.63 0.00 4.41
1295 1377 4.340666 TGGCAAGTTTTGTGCTAAGATGAA 59.659 37.500 0.00 0.00 41.88 2.57
1669 1751 9.364989 TGAAGAAGTTGAAAAAGGTAAAACATG 57.635 29.630 0.00 0.00 0.00 3.21
1734 1816 8.763601 GGTGCAGGATTCTATATAAGGTAGAAT 58.236 37.037 7.82 7.82 46.31 2.40
2060 2148 8.853077 ACATTCAGACATTCAAATCTCTACAA 57.147 30.769 0.00 0.00 0.00 2.41
2275 2363 3.728864 CGGCAATACAAGTGATGCAGAAC 60.729 47.826 12.09 0.00 40.51 3.01
2381 2469 0.966179 CCATACGATGATCGGGGTGA 59.034 55.000 19.82 0.00 45.59 4.02
2382 2470 1.336887 CCATACGATGATCGGGGTGAC 60.337 57.143 19.82 0.00 45.59 3.67
2484 2572 1.966901 TATGCCGCGAACCTGGACAT 61.967 55.000 8.23 0.58 0.00 3.06
2758 2846 1.664016 GCTGTGTGCCACAAATCTTCG 60.664 52.381 0.00 0.00 44.08 3.79
2929 3018 3.774766 AGCTGTGAACACATACCCTGATA 59.225 43.478 8.09 0.00 41.01 2.15
3026 3115 1.115467 AGACCGATACCTTGCCTCTG 58.885 55.000 0.00 0.00 0.00 3.35
3145 3235 0.862490 CAAATCGGTGTGTGCGTACA 59.138 50.000 0.82 0.82 0.00 2.90
3206 3296 0.168788 AATTTGATGCGCAGGTGTCG 59.831 50.000 18.32 0.00 0.00 4.35
3256 3346 2.038690 TCGACAAGCGAGGTCAGTT 58.961 52.632 6.33 0.00 45.59 3.16
3477 3567 4.935578 TGGAGATCAGACAGAAGAACCTA 58.064 43.478 0.00 0.00 0.00 3.08
3483 3573 6.495181 AGATCAGACAGAAGAACCTAAAGTCA 59.505 38.462 0.00 0.00 0.00 3.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
316 333 4.687901 TCACCACATCTTTCAGTGAGAA 57.312 40.909 0.00 0.00 37.97 2.87
659 684 5.773680 TCCAAAGTAGTAGTACTGTGCTCTT 59.226 40.000 19.03 3.86 41.61 2.85
1165 1247 0.749091 TGCTCCCATGCCGATTCAAG 60.749 55.000 0.00 0.00 0.00 3.02
1295 1377 2.693250 TTCACTGCGCTGCGTACTGT 62.693 55.000 24.04 14.19 0.00 3.55
1669 1751 2.866762 GGATGGTATCGTCTGACAAAGC 59.133 50.000 8.73 2.84 0.00 3.51
1734 1816 2.967745 TGTGGTCCATCATCAACCAA 57.032 45.000 0.00 0.00 44.30 3.67
2060 2148 1.202639 TCACGACTTCAAGTGCATGGT 60.203 47.619 0.00 0.00 38.19 3.55
2275 2363 1.290203 AAATCACCGATAGCACTGCG 58.710 50.000 0.00 0.00 0.00 5.18
2381 2469 7.026562 GCATTGTTTTAACCTTTTGCTTTTGT 58.973 30.769 0.00 0.00 0.00 2.83
2382 2470 7.025963 TGCATTGTTTTAACCTTTTGCTTTTG 58.974 30.769 0.00 0.00 0.00 2.44
2484 2572 1.202592 TGCGGACAAGTTGTGCTCTTA 60.203 47.619 22.93 5.99 36.50 2.10
2533 2621 3.881937 ATTTGAGCATTTTGCCTCCTC 57.118 42.857 0.00 0.00 46.52 3.71
2758 2846 6.619801 ACTTGTTCAGTCCACAATAAGTTC 57.380 37.500 0.00 0.00 31.94 3.01
3145 3235 6.153067 GCAGACATATCTAAACTCGTATGCT 58.847 40.000 0.00 0.00 38.27 3.79
3190 3280 2.027073 GACGACACCTGCGCATCAA 61.027 57.895 12.24 0.00 0.00 2.57
3200 3290 1.996191 GAAGCAGATCTTGACGACACC 59.004 52.381 0.00 0.00 34.56 4.16
3206 3296 1.272781 CGACCGAAGCAGATCTTGAC 58.727 55.000 0.00 0.00 34.56 3.18
3477 3567 4.084328 CGCTGAAAGACGAGATTTGACTTT 60.084 41.667 0.00 0.00 35.93 2.66
3483 3573 2.338500 GACCGCTGAAAGACGAGATTT 58.662 47.619 0.00 0.00 35.93 2.17


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.