Multiple sequence alignment - TraesCS7D01G160700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G160700 chr7D 100.000 4009 0 0 1 4009 111050672 111046664 0.000000e+00 7404
1 TraesCS7D01G160700 chr4D 99.252 4010 19 2 1 4009 9319685 9315686 0.000000e+00 7228
2 TraesCS7D01G160700 chr4D 98.485 1254 9 1 2756 4009 9324469 9325712 0.000000e+00 2202
3 TraesCS7D01G160700 chr4D 96.241 399 5 1 3611 4009 9329942 9330330 0.000000e+00 645
4 TraesCS7D01G160700 chr7B 95.070 3164 98 17 713 3827 70483597 70480443 0.000000e+00 4926
5 TraesCS7D01G160700 chr7B 89.696 427 31 6 291 714 70484085 70483669 2.120000e-147 532
6 TraesCS7D01G160700 chr7B 90.341 176 2 2 3831 3992 70480407 70480233 2.430000e-52 217
7 TraesCS7D01G160700 chr7B 83.417 199 17 7 1 196 70484377 70484192 1.920000e-38 171
8 TraesCS7D01G160700 chr7A 94.755 3165 106 20 713 3827 116116105 116112951 0.000000e+00 4870
9 TraesCS7D01G160700 chr7A 90.000 730 52 12 1 714 116117068 116116344 0.000000e+00 924
10 TraesCS7D01G160700 chr7A 96.000 100 4 0 3907 4006 116112815 116112716 3.210000e-36 163
11 TraesCS7D01G160700 chr7A 96.552 87 2 1 3827 3913 116112922 116112837 4.180000e-30 143
12 TraesCS7D01G160700 chr5D 92.123 2577 145 32 857 3391 37194217 37191657 0.000000e+00 3581
13 TraesCS7D01G160700 chr5D 90.513 1170 105 4 1885 3053 430442231 430443395 0.000000e+00 1541
14 TraesCS7D01G160700 chr5D 91.137 1117 95 4 730 1842 430441112 430442228 0.000000e+00 1511
15 TraesCS7D01G160700 chr5A 90.737 2699 184 32 732 3384 26157135 26154457 0.000000e+00 3539
16 TraesCS7D01G160700 chr5A 93.023 1204 77 7 718 1916 545973662 545974863 0.000000e+00 1751
17 TraesCS7D01G160700 chr5A 90.859 1083 61 6 1991 3072 545981317 545982362 0.000000e+00 1417
18 TraesCS7D01G160700 chr5A 83.085 201 31 3 305 504 545973191 545973389 3.180000e-41 180
19 TraesCS7D01G160700 chr5B 88.980 1098 114 5 1957 3053 519642192 519643283 0.000000e+00 1351
20 TraesCS7D01G160700 chr5B 89.718 817 76 8 716 1528 519614480 519615292 0.000000e+00 1037
21 TraesCS7D01G160700 chr5B 90.575 435 40 1 1525 1959 519628316 519628749 3.470000e-160 575
22 TraesCS7D01G160700 chr5B 83.193 238 29 6 30 258 519613984 519614219 1.460000e-49 207
23 TraesCS7D01G160700 chr3D 86.494 770 98 6 1172 1937 580546711 580547478 0.000000e+00 841


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G160700 chr7D 111046664 111050672 4008 True 7404.0 7404 100.00000 1 4009 1 chr7D.!!$R1 4008
1 TraesCS7D01G160700 chr4D 9315686 9319685 3999 True 7228.0 7228 99.25200 1 4009 1 chr4D.!!$R1 4008
2 TraesCS7D01G160700 chr4D 9324469 9325712 1243 False 2202.0 2202 98.48500 2756 4009 1 chr4D.!!$F1 1253
3 TraesCS7D01G160700 chr7B 70480233 70484377 4144 True 1461.5 4926 89.63100 1 3992 4 chr7B.!!$R1 3991
4 TraesCS7D01G160700 chr7A 116112716 116117068 4352 True 1525.0 4870 94.32675 1 4006 4 chr7A.!!$R1 4005
5 TraesCS7D01G160700 chr5D 37191657 37194217 2560 True 3581.0 3581 92.12300 857 3391 1 chr5D.!!$R1 2534
6 TraesCS7D01G160700 chr5D 430441112 430443395 2283 False 1526.0 1541 90.82500 730 3053 2 chr5D.!!$F1 2323
7 TraesCS7D01G160700 chr5A 26154457 26157135 2678 True 3539.0 3539 90.73700 732 3384 1 chr5A.!!$R1 2652
8 TraesCS7D01G160700 chr5A 545981317 545982362 1045 False 1417.0 1417 90.85900 1991 3072 1 chr5A.!!$F1 1081
9 TraesCS7D01G160700 chr5A 545973191 545974863 1672 False 965.5 1751 88.05400 305 1916 2 chr5A.!!$F2 1611
10 TraesCS7D01G160700 chr5B 519642192 519643283 1091 False 1351.0 1351 88.98000 1957 3053 1 chr5B.!!$F2 1096
11 TraesCS7D01G160700 chr5B 519613984 519615292 1308 False 622.0 1037 86.45550 30 1528 2 chr5B.!!$F3 1498
12 TraesCS7D01G160700 chr3D 580546711 580547478 767 False 841.0 841 86.49400 1172 1937 1 chr3D.!!$F1 765

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
785 1145 4.987963 AGGATGCACTGATAATGATGGA 57.012 40.909 0.00 0.0 0.00 3.41 F
1728 2113 0.933097 GATGTGCAGTATCACCGCTG 59.067 55.000 6.11 0.0 36.17 5.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2512 2900 1.680207 GGATGAGCATTGCCTTCTTCC 59.320 52.381 13.57 13.57 0.00 3.46 R
3780 4248 2.036098 TGGGGCCAGACAATGCTG 59.964 61.111 4.39 0.00 35.66 4.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
287 297 5.296035 GGGGATGGTTGATTAGTAGTTTTCG 59.704 44.000 0.00 0.00 0.00 3.46
608 706 8.780249 GTGGTTCAACTATTTTTAGCTACTGAA 58.220 33.333 0.00 0.00 0.00 3.02
785 1145 4.987963 AGGATGCACTGATAATGATGGA 57.012 40.909 0.00 0.00 0.00 3.41
1482 1865 3.138798 CAGCACATGGCCAGGCTC 61.139 66.667 22.34 12.87 46.50 4.70
1728 2113 0.933097 GATGTGCAGTATCACCGCTG 59.067 55.000 6.11 0.00 36.17 5.18
2106 2491 5.311265 AGTCAAAGAAGATCAATGACTGCA 58.689 37.500 14.18 0.00 46.48 4.41
2512 2900 7.629652 GCGAGAGATATTGGGTAAGATTAGGAG 60.630 44.444 0.00 0.00 0.00 3.69
2660 3048 0.535102 CCATGGGCGTTGATCCTACC 60.535 60.000 2.85 0.00 0.00 3.18
3780 4248 4.021925 ACCCCCTCAGTTGCGCTC 62.022 66.667 9.73 1.40 0.00 5.03
3829 4329 3.433306 TGGTAAATGGCAAGTGCTAGT 57.567 42.857 2.85 0.00 41.70 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
608 706 3.292492 AGTCAAGGTCCGGTTTCTTTT 57.708 42.857 0.00 0.00 0.00 2.27
1482 1865 2.028203 GGTGTTTGGGTCAATTGATGGG 60.028 50.000 12.12 0.00 0.00 4.00
1728 2113 1.860484 GCAGCCCTCAAGTGAGCAAC 61.860 60.000 2.59 0.00 40.75 4.17
2106 2491 6.332630 GCATAGCAACATGAAACCTGTTTAT 58.667 36.000 0.00 0.00 34.69 1.40
2512 2900 1.680207 GGATGAGCATTGCCTTCTTCC 59.320 52.381 13.57 13.57 0.00 3.46
3780 4248 2.036098 TGGGGCCAGACAATGCTG 59.964 61.111 4.39 0.00 35.66 4.41
3829 4329 8.924511 ATGATTAAGTTCCTCTTGAGAAACAA 57.075 30.769 2.81 0.00 37.56 2.83
3965 4493 7.071196 TGCCTTGTATCCAAGTGAGTATAGAAT 59.929 37.037 0.00 0.00 45.49 2.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.