Multiple sequence alignment - TraesCS7D01G159000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G159000 chr7D 100.000 3999 0 0 1 3999 108265485 108261487 0.000000e+00 7385
1 TraesCS7D01G159000 chr7D 98.576 4002 41 15 1 3999 108302405 108298417 0.000000e+00 7060
2 TraesCS7D01G159000 chr7D 97.877 4004 52 23 1 3999 21682202 21678227 0.000000e+00 6892
3 TraesCS7D01G159000 chr5D 98.627 4007 35 15 1 3999 30634479 30630485 0.000000e+00 7077
4 TraesCS7D01G159000 chr5D 98.227 2030 26 8 1 2028 420310680 420308659 0.000000e+00 3541
5 TraesCS7D01G159000 chr5D 98.247 1997 23 9 2013 3999 420308643 420306649 0.000000e+00 3483
6 TraesCS7D01G159000 chr2D 98.427 4004 48 12 1 3999 343143640 343139647 0.000000e+00 7031
7 TraesCS7D01G159000 chr1D 98.799 3413 29 11 1 3408 66200712 66197307 0.000000e+00 6065
8 TraesCS7D01G159000 chr1D 97.542 651 8 1 3349 3999 66197308 66196666 0.000000e+00 1107
9 TraesCS7D01G159000 chr6A 92.650 2966 162 40 678 3607 615412802 615409857 0.000000e+00 4218
10 TraesCS7D01G159000 chr6A 90.625 704 39 20 1 687 615413623 615412930 0.000000e+00 909
11 TraesCS7D01G159000 chr6A 93.651 126 8 0 3788 3913 615409750 615409625 5.280000e-44 189
12 TraesCS7D01G159000 chr4B 86.279 2908 286 75 1159 3997 638493177 638490314 0.000000e+00 3055
13 TraesCS7D01G159000 chr7B 86.004 2908 297 75 1159 3997 712608227 712611093 0.000000e+00 3014
14 TraesCS7D01G159000 chr7B 86.364 374 41 8 678 1047 712607804 712608171 2.240000e-107 399
15 TraesCS7D01G159000 chr3A 94.632 1863 81 15 678 2532 735465089 735466940 0.000000e+00 2868
16 TraesCS7D01G159000 chr3A 89.736 1023 75 22 2595 3600 735466937 735467946 0.000000e+00 1280
17 TraesCS7D01G159000 chr3A 91.989 699 32 16 1 687 735464264 735464950 0.000000e+00 959
18 TraesCS7D01G159000 chr1B 84.942 2683 286 71 1168 3787 621586241 621583614 0.000000e+00 2608
19 TraesCS7D01G159000 chr1B 86.875 160 19 2 3839 3997 621583603 621583445 1.140000e-40 178
20 TraesCS7D01G159000 chr3B 82.596 1356 178 38 2659 3999 160438175 160436863 0.000000e+00 1144
21 TraesCS7D01G159000 chr3B 83.969 131 16 4 3869 3999 160499122 160498997 1.950000e-23 121


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G159000 chr7D 108261487 108265485 3998 True 7385.000000 7385 100.000000 1 3999 1 chr7D.!!$R2 3998
1 TraesCS7D01G159000 chr7D 108298417 108302405 3988 True 7060.000000 7060 98.576000 1 3999 1 chr7D.!!$R3 3998
2 TraesCS7D01G159000 chr7D 21678227 21682202 3975 True 6892.000000 6892 97.877000 1 3999 1 chr7D.!!$R1 3998
3 TraesCS7D01G159000 chr5D 30630485 30634479 3994 True 7077.000000 7077 98.627000 1 3999 1 chr5D.!!$R1 3998
4 TraesCS7D01G159000 chr5D 420306649 420310680 4031 True 3512.000000 3541 98.237000 1 3999 2 chr5D.!!$R2 3998
5 TraesCS7D01G159000 chr2D 343139647 343143640 3993 True 7031.000000 7031 98.427000 1 3999 1 chr2D.!!$R1 3998
6 TraesCS7D01G159000 chr1D 66196666 66200712 4046 True 3586.000000 6065 98.170500 1 3999 2 chr1D.!!$R1 3998
7 TraesCS7D01G159000 chr6A 615409625 615413623 3998 True 1772.000000 4218 92.308667 1 3913 3 chr6A.!!$R1 3912
8 TraesCS7D01G159000 chr4B 638490314 638493177 2863 True 3055.000000 3055 86.279000 1159 3997 1 chr4B.!!$R1 2838
9 TraesCS7D01G159000 chr7B 712607804 712611093 3289 False 1706.500000 3014 86.184000 678 3997 2 chr7B.!!$F1 3319
10 TraesCS7D01G159000 chr3A 735464264 735467946 3682 False 1702.333333 2868 92.119000 1 3600 3 chr3A.!!$F1 3599
11 TraesCS7D01G159000 chr1B 621583445 621586241 2796 True 1393.000000 2608 85.908500 1168 3997 2 chr1B.!!$R1 2829
12 TraesCS7D01G159000 chr3B 160436863 160438175 1312 True 1144.000000 1144 82.596000 2659 3999 1 chr3B.!!$R1 1340

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
389 405 6.639632 AGCAACAACATGTCAAAGAGTTAT 57.360 33.333 0.0 0.0 0.0 1.89 F
1038 1209 4.095782 GTCCTACACAAAAGCACAAGAACA 59.904 41.667 0.0 0.0 0.0 3.18 F
1253 1435 4.657814 ACAGCAATTTTAGGGAAGAGGA 57.342 40.909 0.0 0.0 0.0 3.71 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1527 1728 4.247258 TCGTGTTGTATAAATTGTCCGCT 58.753 39.130 0.00 0.0 0.00 5.52 R
2981 3276 4.082787 ACCAATTTACCATGCGAAGTTCTG 60.083 41.667 0.56 0.0 0.00 3.02 R
3415 3800 4.996758 GGACATTCCAAATTGTTTTCTGGG 59.003 41.667 0.00 0.0 36.28 4.45 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
389 405 6.639632 AGCAACAACATGTCAAAGAGTTAT 57.360 33.333 0.00 0.0 0.00 1.89
1037 1208 4.335594 AGTCCTACACAAAAGCACAAGAAC 59.664 41.667 0.00 0.0 0.00 3.01
1038 1209 4.095782 GTCCTACACAAAAGCACAAGAACA 59.904 41.667 0.00 0.0 0.00 3.18
1253 1435 4.657814 ACAGCAATTTTAGGGAAGAGGA 57.342 40.909 0.00 0.0 0.00 3.71
1337 1525 6.183360 CCCTGTAAGTGACTACCTACATGTAC 60.183 46.154 0.08 0.0 34.24 2.90
1527 1728 6.538945 TCATGCTCTAGTATGGTAAACACA 57.461 37.500 8.00 0.0 38.44 3.72
2039 2280 7.318141 AGAAATTTCATATCCAAGCACAACTG 58.682 34.615 19.99 0.0 0.00 3.16
2345 2605 5.386810 TTTTGCAATCAAATTGTGTGTCG 57.613 34.783 0.00 0.0 41.37 4.35
2981 3276 3.312697 GGATCAAGGCAAAATACTCGTCC 59.687 47.826 0.00 0.0 0.00 4.79
3415 3800 5.758570 GTGTCGTAGAAACTGGTCATTAC 57.241 43.478 0.00 0.0 42.59 1.89
3950 4360 7.444299 AGTGCATTTACATTTTTCCAGTCATT 58.556 30.769 0.00 0.0 0.00 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
389 405 5.692115 TCTAATGGATGCAAAGTGTCCTA 57.308 39.130 4.96 0.0 33.15 2.94
1527 1728 4.247258 TCGTGTTGTATAAATTGTCCGCT 58.753 39.130 0.00 0.0 0.00 5.52
2981 3276 4.082787 ACCAATTTACCATGCGAAGTTCTG 60.083 41.667 0.56 0.0 0.00 3.02
3415 3800 4.996758 GGACATTCCAAATTGTTTTCTGGG 59.003 41.667 0.00 0.0 36.28 4.45


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.