AutoCloner

Multiple sequence alignment - TraesCS7D01G137800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)

BLAST Results

Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

	qseqid	sseqid	percentage.identical	alignment.length	no.mismatch	no.gap.openings	qstart	qend	sstart	send	evalue	bitscore
0	TraesCS7D01G137800	chr7D	100.000	3192	0	0	1	3192	88371618	88368427	0.000000e+00	5895.0
1	TraesCS7D01G137800	chr7D	78.994	895	157	19	826	1707	88133353	88134229	1.650000e-162	582.0
2	TraesCS7D01G137800	chr7D	81.645	681	111	9	826	1503	88180216	88179547	1.290000e-153	553.0
3	TraesCS7D01G137800	chr7D	83.929	560	90	0	843	1402	88078632	88079191	1.300000e-148	536.0
4	TraesCS7D01G137800	chr7D	79.752	726	112	19	829	1535	89232399	89233108	7.950000e-136	494.0
5	TraesCS7D01G137800	chr7B	93.207	1428	88	2	598	2019	38660594	38659170	0.000000e+00	2091.0
6	TraesCS7D01G137800	chr7B	89.404	1425	112	14	603	2019	38782911	38784304	0.000000e+00	1759.0
7	TraesCS7D01G137800	chr7B	93.224	428	26	2	1	425	38661201	38660774	7.520000e-176	627.0
8	TraesCS7D01G137800	chr7B	83.871	589	89	3	832	1414	36991378	36991966	1.000000e-154	556.0
9	TraesCS7D01G137800	chr7B	86.874	419	26	8	2022	2436	38659135	38658742	2.920000e-120	442.0
10	TraesCS7D01G137800	chr7B	81.538	585	46	21	2417	2978	38630929	38630384	2.940000e-115	425.0
11	TraesCS7D01G137800	chr7B	86.667	330	40	3	2647	2976	38624128	38623803	2.340000e-96	363.0
12	TraesCS7D01G137800	chr7B	95.000	180	8	1	2021	2199	38784338	38784517	6.740000e-72	281.0
13	TraesCS7D01G137800	chr7B	100.000	29	0	0	3157	3185	38623754	38623726	2.000000e-03	54.7
14	TraesCS7D01G137800	chr7A	90.197	1418	86	12	603	2019	89974250	89975615	0.000000e+00	1799.0
15	TraesCS7D01G137800	chr7A	88.889	963	61	22	2025	2976	89964033	89963106	0.000000e+00	1144.0
16	TraesCS7D01G137800	chr7A	89.765	850	71	8	1177	2019	89964933	89964093	0.000000e+00	1074.0
17	TraesCS7D01G137800	chr7A	94.937	395	18	2	794	1187	89965818	89965425	4.520000e-173	617.0
18	TraesCS7D01G137800	chr7A	86.898	519	66	2	854	1371	89649553	89650070	5.940000e-162	580.0
19	TraesCS7D01G137800	chr7A	94.403	268	15	0	1609	1876	89947335	89947068	2.290000e-111	412.0
20	TraesCS7D01G137800	chr7A	93.258	178	11	1	2022	2198	89975650	89975827	8.780000e-66	261.0
21	TraesCS7D01G137800	chr7A	86.878	221	20	3	2754	2974	89932745	89932534	4.120000e-59	239.0
22	TraesCS7D01G137800	chr7A	94.231	156	8	1	270	425	89966282	89966128	1.480000e-58	237.0
23	TraesCS7D01G137800	chr7A	85.581	215	15	11	569	782	89965995	89965796	8.970000e-51	211.0
24	TraesCS7D01G137800	chr7A	91.176	136	12	0	2347	2482	89947067	89946932	5.440000e-43	185.0
25	TraesCS7D01G137800	chr7A	82.500	80	13	1	2038	2116	90455266	90455345	5.710000e-08	69.4
26	TraesCS7D01G137800	chr2A	91.822	428	32	3	1	425	50443365	50442938	7.620000e-166	593.0
27	TraesCS7D01G137800	chr2A	84.962	133	9	6	651	782	50442523	50442401	1.200000e-24	124.0
28	TraesCS7D01G137800	chr2A	80.952	84	6	5	3111	3185	50440630	50440548	1.240000e-04	58.4
29	TraesCS7D01G137800	chr6B	84.314	255	20	12	1	255	595205879	595206113	6.890000e-57	231.0
30	TraesCS7D01G137800	chr1D	81.609	261	43	5	2	260	353553882	353553625	8.970000e-51	211.0
31	TraesCS7D01G137800	chr5A	95.385	65	3	0	2442	2506	563176388	563176452	1.570000e-18	104.0
32	TraesCS7D01G137800	chr2D	93.846	65	4	0	2442	2506	200944737	200944673	7.290000e-17	99.0
33	TraesCS7D01G137800	chr2D	93.846	65	4	0	2442	2506	604426696	604426632	7.290000e-17	99.0
34	TraesCS7D01G137800	chrUn	92.308	65	5	0	2442	2506	45089464	45089528	3.390000e-15	93.5
35	TraesCS7D01G137800	chrUn	92.308	65	5	0	2442	2506	171039751	171039815	3.390000e-15	93.5
36	TraesCS7D01G137800	chr4D	92.308	65	5	0	2442	2506	398045325	398045261	3.390000e-15	93.5
37	TraesCS7D01G137800	chr4D	89.286	56	6	0	287	342	30297636	30297691	1.590000e-08	71.3

These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

	query	scaffold	start	end	length	rev.comp	avg.bitscore	max.bitscore	avg.percent.identical	query.start	query.end	num_hsp	groupid	homo_length
0	TraesCS7D01G137800	chr7D	88368427	88371618	3191	True	5895.000000	5895	100.000000	1	3192	1	chr7D.!!$R2	3191
1	TraesCS7D01G137800	chr7D	88133353	88134229	876	False	582.000000	582	78.994000	826	1707	1	chr7D.!!$F2	881
2	TraesCS7D01G137800	chr7D	88179547	88180216	669	True	553.000000	553	81.645000	826	1503	1	chr7D.!!$R1	677
3	TraesCS7D01G137800	chr7D	88078632	88079191	559	False	536.000000	536	83.929000	843	1402	1	chr7D.!!$F1	559
4	TraesCS7D01G137800	chr7D	89232399	89233108	709	False	494.000000	494	79.752000	829	1535	1	chr7D.!!$F3	706
5	TraesCS7D01G137800	chr7B	38658742	38661201	2459	True	1053.333333	2091	91.101667	1	2436	3	chr7B.!!$R3	2435
6	TraesCS7D01G137800	chr7B	38782911	38784517	1606	False	1020.000000	1759	92.202000	603	2199	2	chr7B.!!$F2	1596
7	TraesCS7D01G137800	chr7B	36991378	36991966	588	False	556.000000	556	83.871000	832	1414	1	chr7B.!!$F1	582
8	TraesCS7D01G137800	chr7B	38630384	38630929	545	True	425.000000	425	81.538000	2417	2978	1	chr7B.!!$R1	561
9	TraesCS7D01G137800	chr7A	89974250	89975827	1577	False	1030.000000	1799	91.727500	603	2198	2	chr7A.!!$F3	1595
10	TraesCS7D01G137800	chr7A	89963106	89966282	3176	True	656.600000	1144	90.680600	270	2976	5	chr7A.!!$R3	2706
11	TraesCS7D01G137800	chr7A	89649553	89650070	517	False	580.000000	580	86.898000	854	1371	1	chr7A.!!$F1	517
12	TraesCS7D01G137800	chr2A	50440548	50443365	2817	True	258.466667	593	85.912000	1	3185	3	chr2A.!!$R1	3184

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
535	620	0.034337	TTACACAGACCCTTCACGGC	59.966	55.0	0.0	0.0	0.0	5.68	F

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
2194	3590	1.0756	GCTCTCCTGCTACCCTCCT	60.076	63.158	0.0	0.0	0.0	3.69	R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability
29	30	9.044150	CATCTTTTCTTGCAAAAGAAACCATTA	57.956	29.630	14.33	0.55	45.37	1.90
33	34	8.553459	TTTCTTGCAAAAGAAACCATTAACAA	57.447	26.923	9.09	0.00	42.10	2.83
36	37	7.491048	TCTTGCAAAAGAAACCATTAACAAGTC	59.509	33.333	0.00	0.00	34.06	3.01
59	61	3.963129	TCATTGGCGGATCTAAAAAGGT	58.037	40.909	0.00	0.00	0.00	3.50
81	83	4.710528	AAGCGAAAAACGTCTCTAAGTG	57.289	40.909	0.00	0.00	44.60	3.16
106	109	7.500227	TGCATTAGGATCTCAAGATTGTAAAGG	59.500	37.037	0.00	0.00	34.37	3.11
130	133	1.409064	CTATGCAGGCTACCAAGACGA	59.591	52.381	0.00	0.00	35.06	4.20
177	180	4.558226	TGATAGCAGGTCTGATTGTGTT	57.442	40.909	1.65	0.00	0.00	3.32
182	185	8.264347	TGATAGCAGGTCTGATTGTGTTATTTA	58.736	33.333	1.65	0.00	0.00	1.40
218	221	2.159572	CCTGCGTGGCAAACTATGTAAC	60.160	50.000	0.00	0.00	38.41	2.50
346	351	2.161855	ACGCTTGATGAGATTTGGCAA	58.838	42.857	0.00	0.00	0.00	4.52
363	368	3.368539	TGGCAAAACGTGTTATAGTAGCG	59.631	43.478	0.00	0.00	0.00	4.26
404	409	7.445121	TGACACTACAGATTTTTCATGAGAGT	58.555	34.615	0.00	0.00	0.00	3.24
405	410	7.933577	TGACACTACAGATTTTTCATGAGAGTT	59.066	33.333	0.00	0.00	0.00	3.01
425	430	2.425143	TTCATTCCAGAGGTGCCATC	57.575	50.000	0.00	0.00	0.00	3.51
426	431	0.178767	TCATTCCAGAGGTGCCATCG	59.821	55.000	0.00	0.00	0.00	3.84
427	432	0.178767	CATTCCAGAGGTGCCATCGA	59.821	55.000	0.00	0.00	0.00	3.59
429	434	1.899437	TTCCAGAGGTGCCATCGACC	61.899	60.000	0.00	0.00	0.00	4.79
430	435	2.659063	CCAGAGGTGCCATCGACCA	61.659	63.158	0.00	0.00	35.76	4.02
431	436	1.296392	CAGAGGTGCCATCGACCAA	59.704	57.895	0.00	0.00	35.76	3.67
432	437	0.107508	CAGAGGTGCCATCGACCAAT	60.108	55.000	0.00	0.00	35.76	3.16
434	439	1.004745	AGAGGTGCCATCGACCAATTT	59.995	47.619	0.00	0.00	35.76	1.82
435	440	1.818674	GAGGTGCCATCGACCAATTTT	59.181	47.619	0.00	0.00	35.76	1.82
466	551	9.862585	AAAACAATATCGAGCAATTTTTGTTTC	57.137	25.926	13.77	0.00	0.00	2.78
487	572	2.360483	CTGATGCAGTGAGTATCGTCCT	59.640	50.000	0.00	0.00	41.68	3.85

Showing 1 to 25 of 224 entries

Previous1 2 3 4 5…9Next

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability
29	30	2.270352	TCCGCCAATGAAGACTTGTT	57.730	45.000	0.00	0.00	0.00	2.83
33	34	4.487714	TTTAGATCCGCCAATGAAGACT	57.512	40.909	0.00	0.00	0.00	3.24
36	37	4.399303	ACCTTTTTAGATCCGCCAATGAAG	59.601	41.667	0.00	0.00	0.00	3.02
42	43	3.275999	GCTTACCTTTTTAGATCCGCCA	58.724	45.455	0.00	0.00	0.00	5.69
59	61	4.149396	GCACTTAGAGACGTTTTTCGCTTA	59.851	41.667	0.00	0.00	44.19	3.09
81	83	7.500559	ACCTTTACAATCTTGAGATCCTAATGC	59.499	37.037	0.00	0.00	32.75	3.56
106	109	1.672881	CTTGGTAGCCTGCATAGCAAC	59.327	52.381	11.08	1.63	38.41	4.17
130	133	7.088589	AGCTAAATTTTGTAATCTCATGCGT	57.911	32.000	0.00	0.00	0.00	5.24
177	180	7.429636	GCAGGGCGAAACACTATTATAAATA	57.570	36.000	0.00	0.00	0.00	1.40
218	221	8.874745	AATAACAATGTTCTTACAATCGTTCG	57.125	30.769	0.22	0.00	37.91	3.95
264	267	3.679502	GCAGGCAGCGAAACATTTTATTT	59.320	39.130	0.00	0.00	0.00	1.40
265	268	3.253230	GCAGGCAGCGAAACATTTTATT	58.747	40.909	0.00	0.00	0.00	1.40
267	270	2.346099	GCAGGCAGCGAAACATTTTA	57.654	45.000	0.00	0.00	0.00	1.52
346	351	3.119388	TGAGCCGCTACTATAACACGTTT	60.119	43.478	0.00	0.00	0.00	3.60
363	368	3.817647	AGTGTCATGTTCTTTTCTGAGCC	59.182	43.478	0.00	0.00	0.00	4.70
404	409	2.673775	TGGCACCTCTGGAATGAAAA	57.326	45.000	0.00	0.00	0.00	2.29
405	410	2.726821	GATGGCACCTCTGGAATGAAA	58.273	47.619	0.00	0.00	0.00	2.69
441	446	9.260002	AGAAACAAAAATTGCTCGATATTGTTT	57.740	25.926	17.46	17.46	46.28	2.83
443	448	8.081633	TCAGAAACAAAAATTGCTCGATATTGT	58.918	29.630	0.00	0.00	0.00	2.71
444	449	8.451687	TCAGAAACAAAAATTGCTCGATATTG	57.548	30.769	0.00	0.00	0.00	1.90
466	551	2.360483	AGGACGATACTCACTGCATCAG	59.640	50.000	0.00	0.00	37.52	2.90
487	572	6.403527	CGATTTGAAGGCTGATTGTGATTACA	60.404	38.462	0.00	0.00	34.31	2.41
499	584	2.734606	TGTAACGTCGATTTGAAGGCTG	59.265	45.455	0.00	0.00	0.00	4.85
500	585	2.735134	GTGTAACGTCGATTTGAAGGCT	59.265	45.455	0.00	0.00	0.00	4.58
501	586	2.477375	TGTGTAACGTCGATTTGAAGGC	59.523	45.455	0.00	0.00	42.39	4.35

Showing 1 to 25 of 224 entries

Previous1 2 3 4 5…9Next

Based at the University of Bristol with support from BBSRC.

AutoCloner maintained by Alex Coulton.