Multiple sequence alignment - TraesCS7D01G134600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G134600 chr7D 100.000 2919 0 0 1 2919 86063183 86066101 0.000000e+00 5391.0
1 TraesCS7D01G134600 chr7A 95.744 2937 95 9 1 2919 675504571 675501647 0.000000e+00 4704.0
2 TraesCS7D01G134600 chr7A 87.088 1789 209 20 625 2400 102071236 102069457 0.000000e+00 2004.0
3 TraesCS7D01G134600 chr7A 83.285 347 41 10 2393 2723 102062946 102062601 1.310000e-78 303.0
4 TraesCS7D01G134600 chr7A 91.791 134 11 0 2783 2916 102062516 102062383 1.380000e-43 187.0
5 TraesCS7D01G134600 chr2B 88.728 2759 239 36 186 2908 259695651 259692929 0.000000e+00 3306.0
6 TraesCS7D01G134600 chr2B 86.316 190 25 1 1 190 259718810 259718622 3.810000e-49 206.0
7 TraesCS7D01G134600 chr5A 79.503 1893 344 36 696 2569 570191056 570192923 0.000000e+00 1306.0
8 TraesCS7D01G134600 chr3B 79.341 1336 245 24 693 2006 232600923 232599597 0.000000e+00 909.0
9 TraesCS7D01G134600 chr6B 86.702 188 17 7 591 772 713564437 713564622 4.930000e-48 202.0
10 TraesCS7D01G134600 chr6B 85.185 189 19 8 591 772 713332188 713332374 4.970000e-43 185.0
11 TraesCS7D01G134600 chr6B 90.099 101 4 5 588 683 713883949 713884048 3.050000e-25 126.0
12 TraesCS7D01G134600 chr6D 97.436 39 0 1 310 347 23770730 23770692 6.750000e-07 65.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G134600 chr7D 86063183 86066101 2918 False 5391 5391 100.000 1 2919 1 chr7D.!!$F1 2918
1 TraesCS7D01G134600 chr7A 675501647 675504571 2924 True 4704 4704 95.744 1 2919 1 chr7A.!!$R2 2918
2 TraesCS7D01G134600 chr7A 102069457 102071236 1779 True 2004 2004 87.088 625 2400 1 chr7A.!!$R1 1775
3 TraesCS7D01G134600 chr7A 102062383 102062946 563 True 245 303 87.538 2393 2916 2 chr7A.!!$R3 523
4 TraesCS7D01G134600 chr2B 259692929 259695651 2722 True 3306 3306 88.728 186 2908 1 chr2B.!!$R1 2722
5 TraesCS7D01G134600 chr5A 570191056 570192923 1867 False 1306 1306 79.503 696 2569 1 chr5A.!!$F1 1873
6 TraesCS7D01G134600 chr3B 232599597 232600923 1326 True 909 909 79.341 693 2006 1 chr3B.!!$R1 1313

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
767 792 0.031585 GTGTGGACGTGAGCACACTA 59.968 55.0 12.54 0.0 45.53 2.74 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2248 2309 1.676006 AGGACAAAACAGCAAGTTCGG 59.324 47.619 0.0 0.0 40.26 4.3 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
90 91 8.593492 AAATGTGAGTTTTGATTAGCTTTTCC 57.407 30.769 0.00 0.0 0.00 3.13
154 155 3.980775 AGGATCAAAACATTTTGTTCGCG 59.019 39.130 14.95 0.0 45.77 5.87
212 213 2.355209 GGAGGAAGAGACAGCGGATTTT 60.355 50.000 0.00 0.0 0.00 1.82
767 792 0.031585 GTGTGGACGTGAGCACACTA 59.968 55.000 12.54 0.0 45.53 2.74
1168 1203 5.174395 CAAACATCAAAGGTGTGTTTTCCA 58.826 37.500 0.42 0.0 42.35 3.53
1288 1323 0.403271 GATGGACATGGGAGATGGGG 59.597 60.000 0.00 0.0 0.00 4.96
1559 1596 0.178068 ACAATCATAGCCGCGTCCTT 59.822 50.000 4.92 0.0 0.00 3.36
1612 1649 2.277591 GCCAATGAACTGCTGCCCA 61.278 57.895 0.00 0.0 0.00 5.36
1877 1937 2.106477 TTGCGATTACCATGAGCACA 57.894 45.000 0.00 0.0 37.57 4.57
1889 1949 2.693864 AGCACAGGATGGAGGGGG 60.694 66.667 0.00 0.0 43.62 5.40
1890 1950 2.692368 GCACAGGATGGAGGGGGA 60.692 66.667 0.00 0.0 43.62 4.81
1938 1998 5.236695 GCTAGCATCGTACTCGGATATGATA 59.763 44.000 10.63 0.0 37.69 2.15
2187 2248 2.442830 GCTCCCCCTGGATTTGGC 60.443 66.667 0.00 0.0 40.80 4.52
2248 2309 1.111277 ACACTTGTTCCCTTTGTGGC 58.889 50.000 0.00 0.0 33.44 5.01
2400 2464 1.902508 GATGGTTGAGGAGACACAGGA 59.097 52.381 0.00 0.0 30.79 3.86
2631 2712 2.364973 TGCGTGGGGGAGAGCATA 60.365 61.111 0.00 0.0 34.39 3.14
2776 2894 1.949525 CTTGATTACCATGCCCCGAAG 59.050 52.381 0.00 0.0 0.00 3.79
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
23 24 1.032114 CAACATCTTCTTCGGCCCCC 61.032 60.000 0.00 0.00 0.00 5.40
38 39 0.753479 ATGCACCACCGGAAACAACA 60.753 50.000 9.46 0.00 0.00 3.33
90 91 3.438781 ACATGTTTGCACAATACCGGTAG 59.561 43.478 20.91 9.90 36.16 3.18
184 185 1.694150 CTGTCTCTTCCTCCAACCACA 59.306 52.381 0.00 0.00 0.00 4.17
1168 1203 3.203040 CACATTTCTTCCATCCCTACCCT 59.797 47.826 0.00 0.00 0.00 4.34
1288 1323 6.098409 TCCCTAGAGTTCACCTCAATGTAATC 59.902 42.308 0.00 0.00 43.12 1.75
1938 1998 5.603596 TGCTTTTTGATCTGCAGTTTCAAT 58.396 33.333 24.97 9.51 0.00 2.57
2033 2093 7.718314 TCGAACTGGATCTTAGCAACTATACTA 59.282 37.037 0.00 0.00 0.00 1.82
2141 2201 1.749638 CTAGGACTCGGCGTGGTCT 60.750 63.158 24.83 18.01 33.46 3.85
2211 2272 3.452627 AGTGTAGATGGCTAACCTCTTGG 59.547 47.826 0.00 0.00 36.63 3.61
2248 2309 1.676006 AGGACAAAACAGCAAGTTCGG 59.324 47.619 0.00 0.00 40.26 4.30
2400 2464 6.773976 TCCTGATTTCTTCAAACACTTTGT 57.226 33.333 0.00 0.00 41.36 2.83
2776 2894 4.489679 AACGAGAGCCAAATCAACTTTC 57.510 40.909 0.00 0.00 0.00 2.62


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.