Multiple sequence alignment - TraesCS7D01G131500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G131500 chr7D 100.000 3265 0 0 1 3265 83434449 83437713 0.000000e+00 6030.0
1 TraesCS7D01G131500 chr7D 99.020 3265 26 3 1 3265 292322575 292325833 0.000000e+00 5847.0
2 TraesCS7D01G131500 chrUn 99.296 3266 21 2 1 3265 19136311 19139575 0.000000e+00 5903.0
3 TraesCS7D01G131500 chr2D 99.112 3265 28 1 1 3265 142215986 142219249 0.000000e+00 5867.0
4 TraesCS7D01G131500 chr2D 95.171 2216 98 7 340 2550 89876608 89874397 0.000000e+00 3491.0
5 TraesCS7D01G131500 chr4D 99.050 3263 24 5 1 3262 215025811 215022555 0.000000e+00 5847.0
6 TraesCS7D01G131500 chr5A 97.969 2954 56 3 26 2978 427854208 427851258 0.000000e+00 5120.0
7 TraesCS7D01G131500 chr5A 97.484 318 8 0 26 343 65997464 65997781 7.970000e-151 544.0
8 TraesCS7D01G131500 chr5A 100.000 28 0 0 1 28 427854247 427854220 6.000000e-03 52.8
9 TraesCS7D01G131500 chr6A 97.901 2954 59 3 26 2978 517540448 517537497 0.000000e+00 5108.0
10 TraesCS7D01G131500 chr6A 100.000 28 0 0 1 28 517540487 517540460 6.000000e-03 52.8
11 TraesCS7D01G131500 chr2A 95.450 2220 90 5 340 2553 89491533 89489319 0.000000e+00 3530.0
12 TraesCS7D01G131500 chr2B 94.319 2218 114 6 340 2550 142377787 142375575 0.000000e+00 3387.0
13 TraesCS7D01G131500 chr1D 97.190 1957 21 7 1316 3265 460574411 460572482 0.000000e+00 3278.0
14 TraesCS7D01G131500 chr1D 94.497 636 30 5 2631 3265 455913121 455913752 0.000000e+00 976.0
15 TraesCS7D01G131500 chr1D 99.691 324 1 0 1 324 460574734 460574411 7.800000e-166 593.0
16 TraesCS7D01G131500 chr4B 90.199 653 54 6 2618 3262 141029083 141028433 0.000000e+00 843.0
17 TraesCS7D01G131500 chr3B 94.654 318 17 0 26 343 17319559 17319876 8.140000e-136 494.0
18 TraesCS7D01G131500 chr4A 91.536 319 24 1 26 344 96106338 96106653 1.390000e-118 436.0
19 TraesCS7D01G131500 chr5B 88.235 238 25 2 28 262 593466697 593466460 6.900000e-72 281.0
20 TraesCS7D01G131500 chr5B 87.815 238 26 2 28 262 593463818 593463581 3.210000e-70 276.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G131500 chr7D 83434449 83437713 3264 False 6030.0 6030 100.0000 1 3265 1 chr7D.!!$F1 3264
1 TraesCS7D01G131500 chr7D 292322575 292325833 3258 False 5847.0 5847 99.0200 1 3265 1 chr7D.!!$F2 3264
2 TraesCS7D01G131500 chrUn 19136311 19139575 3264 False 5903.0 5903 99.2960 1 3265 1 chrUn.!!$F1 3264
3 TraesCS7D01G131500 chr2D 142215986 142219249 3263 False 5867.0 5867 99.1120 1 3265 1 chr2D.!!$F1 3264
4 TraesCS7D01G131500 chr2D 89874397 89876608 2211 True 3491.0 3491 95.1710 340 2550 1 chr2D.!!$R1 2210
5 TraesCS7D01G131500 chr4D 215022555 215025811 3256 True 5847.0 5847 99.0500 1 3262 1 chr4D.!!$R1 3261
6 TraesCS7D01G131500 chr5A 427851258 427854247 2989 True 2586.4 5120 98.9845 1 2978 2 chr5A.!!$R1 2977
7 TraesCS7D01G131500 chr6A 517537497 517540487 2990 True 2580.4 5108 98.9505 1 2978 2 chr6A.!!$R1 2977
8 TraesCS7D01G131500 chr2A 89489319 89491533 2214 True 3530.0 3530 95.4500 340 2553 1 chr2A.!!$R1 2213
9 TraesCS7D01G131500 chr2B 142375575 142377787 2212 True 3387.0 3387 94.3190 340 2550 1 chr2B.!!$R1 2210
10 TraesCS7D01G131500 chr1D 460572482 460574734 2252 True 1935.5 3278 98.4405 1 3265 2 chr1D.!!$R1 3264
11 TraesCS7D01G131500 chr1D 455913121 455913752 631 False 976.0 976 94.4970 2631 3265 1 chr1D.!!$F1 634
12 TraesCS7D01G131500 chr4B 141028433 141029083 650 True 843.0 843 90.1990 2618 3262 1 chr4B.!!$R1 644
13 TraesCS7D01G131500 chr5B 593463581 593466697 3116 True 278.5 281 88.0250 28 262 2 chr5B.!!$R1 234

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
459 477 4.062991 CAACACTTGAGGGTTGGTAGTAC 58.937 47.826 16.49 0.0 40.44 2.73 F
1093 1980 3.440173 ACACTCATTTAGCAATTGGTCCG 59.560 43.478 14.50 1.5 0.00 4.79 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1290 2177 5.371115 AATCCTTCACGTGGTTGTAAATG 57.629 39.13 17.0 0.0 0.00 2.32 R
3136 4867 0.747852 GAAGGCGAGTTCCTCTAGGG 59.252 60.00 0.0 0.0 34.82 3.53 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
459 477 4.062991 CAACACTTGAGGGTTGGTAGTAC 58.937 47.826 16.49 0.00 40.44 2.73
1093 1980 3.440173 ACACTCATTTAGCAATTGGTCCG 59.560 43.478 14.50 1.50 0.00 4.79
1290 2177 6.128391 GGTTGGTTTTTCTTCTTTTGAACCAC 60.128 38.462 5.34 2.39 44.26 4.16
2616 4338 6.503560 TCGGTTGGGATATAGTTGGTATTT 57.496 37.500 0.00 0.00 0.00 1.40
3136 4867 8.449251 AAGAGGAAGATCTAGAAATTTGCATC 57.551 34.615 0.00 0.00 0.00 3.91
3207 4938 3.154827 TGGGAATTTGTCCTCCAAGTC 57.845 47.619 0.00 0.00 46.92 3.01
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
121 136 1.961180 ATCCTCTTTCCGCACCTCCG 61.961 60.000 0.00 0.0 0.00 4.63
1093 1980 9.169592 TGCAATAACTTAAGGTCTGTAATAACC 57.830 33.333 7.53 0.0 35.69 2.85
1290 2177 5.371115 AATCCTTCACGTGGTTGTAAATG 57.629 39.130 17.00 0.0 0.00 2.32
3136 4867 0.747852 GAAGGCGAGTTCCTCTAGGG 59.252 60.000 0.00 0.0 34.82 3.53
3207 4938 8.790718 CAGATATCAAAGGATCAAAATACCCAG 58.209 37.037 5.32 0.0 34.89 4.45


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.