Multiple sequence alignment - TraesCS7D01G129200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G129200 chr7D 100.000 3227 0 0 1 3227 81359505 81362731 0.000000e+00 5960.0
1 TraesCS7D01G129200 chr7D 99.442 3228 17 1 1 3227 81669040 81665813 0.000000e+00 5860.0
2 TraesCS7D01G129200 chr7D 100.000 1562 0 0 1 1562 81259216 81257655 0.000000e+00 2885.0
3 TraesCS7D01G129200 chr7D 86.374 1299 132 28 873 2151 81773068 81771795 0.000000e+00 1376.0
4 TraesCS7D01G129200 chr7D 93.878 98 5 1 2153 2249 81764854 81764757 2.590000e-31 147.0
5 TraesCS7D01G129200 chr7D 86.957 92 10 2 2964 3053 81764204 81764113 5.700000e-18 102.0
6 TraesCS7D01G129200 chrUn 99.669 2420 7 1 652 3070 341189023 341186604 0.000000e+00 4423.0
7 TraesCS7D01G129200 chr7B 92.609 1556 85 10 721 2251 28680464 28678914 0.000000e+00 2209.0
8 TraesCS7D01G129200 chr7B 87.337 1382 115 19 873 2242 28693749 28692416 0.000000e+00 1528.0
9 TraesCS7D01G129200 chr7B 81.662 698 104 20 873 1552 28764513 28763822 2.810000e-155 558.0
10 TraesCS7D01G129200 chr7B 84.135 416 47 9 2817 3227 28678370 28677969 5.050000e-103 385.0
11 TraesCS7D01G129200 chr7B 90.217 92 9 0 2316 2407 13801855 13801946 1.570000e-23 121.0
12 TraesCS7D01G129200 chr7B 88.732 71 7 1 2399 2469 28678783 28678714 5.740000e-13 86.1
13 TraesCS7D01G129200 chr7A 92.803 931 62 4 1893 2819 83732948 83732019 0.000000e+00 1343.0
14 TraesCS7D01G129200 chr7A 90.141 994 80 14 873 1852 83733935 83732946 0.000000e+00 1277.0
15 TraesCS7D01G129200 chr7A 90.947 243 17 4 2989 3227 83731748 83731507 4.020000e-84 322.0
16 TraesCS7D01G129200 chr7A 85.792 183 14 6 2817 2995 83731973 83731799 1.980000e-42 183.0
17 TraesCS7D01G129200 chr1D 79.347 1225 207 36 1043 2254 434234486 434235677 0.000000e+00 819.0
18 TraesCS7D01G129200 chr1D 88.889 99 8 3 2309 2406 298568648 298568552 5.660000e-23 119.0
19 TraesCS7D01G129200 chr1D 89.247 93 10 0 2316 2408 141706060 141705968 2.030000e-22 117.0
20 TraesCS7D01G129200 chr1A 78.446 1313 228 34 992 2282 532361540 532362819 0.000000e+00 806.0
21 TraesCS7D01G129200 chr1A 81.752 137 16 7 3095 3223 532363773 532363908 4.400000e-19 106.0
22 TraesCS7D01G129200 chr1B 78.403 764 124 28 992 1731 587268006 587268752 2.930000e-125 459.0
23 TraesCS7D01G129200 chr1B 83.044 519 68 15 1741 2254 587273909 587274412 1.360000e-123 453.0
24 TraesCS7D01G129200 chr1B 84.884 86 11 2 2401 2486 587274418 587274501 5.740000e-13 86.1
25 TraesCS7D01G129200 chr1B 85.333 75 9 2 3151 3223 587275419 587275493 3.450000e-10 76.8
26 TraesCS7D01G129200 chr2A 77.637 474 94 9 36 500 774915207 774915677 8.820000e-71 278.0
27 TraesCS7D01G129200 chr6D 94.318 88 5 0 2316 2403 155602045 155601958 5.620000e-28 135.0
28 TraesCS7D01G129200 chr6B 93.182 88 6 0 2316 2403 278674697 278674610 2.610000e-26 130.0
29 TraesCS7D01G129200 chr6A 93.182 88 6 0 2316 2403 209391425 209391338 2.610000e-26 130.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G129200 chr7D 81359505 81362731 3226 False 5960.000000 5960 100.000000 1 3227 1 chr7D.!!$F1 3226
1 TraesCS7D01G129200 chr7D 81665813 81669040 3227 True 5860.000000 5860 99.442000 1 3227 1 chr7D.!!$R2 3226
2 TraesCS7D01G129200 chr7D 81257655 81259216 1561 True 2885.000000 2885 100.000000 1 1562 1 chr7D.!!$R1 1561
3 TraesCS7D01G129200 chr7D 81771795 81773068 1273 True 1376.000000 1376 86.374000 873 2151 1 chr7D.!!$R3 1278
4 TraesCS7D01G129200 chrUn 341186604 341189023 2419 True 4423.000000 4423 99.669000 652 3070 1 chrUn.!!$R1 2418
5 TraesCS7D01G129200 chr7B 28692416 28693749 1333 True 1528.000000 1528 87.337000 873 2242 1 chr7B.!!$R1 1369
6 TraesCS7D01G129200 chr7B 28677969 28680464 2495 True 893.366667 2209 88.492000 721 3227 3 chr7B.!!$R3 2506
7 TraesCS7D01G129200 chr7B 28763822 28764513 691 True 558.000000 558 81.662000 873 1552 1 chr7B.!!$R2 679
8 TraesCS7D01G129200 chr7A 83731507 83733935 2428 True 781.250000 1343 89.920750 873 3227 4 chr7A.!!$R1 2354
9 TraesCS7D01G129200 chr1D 434234486 434235677 1191 False 819.000000 819 79.347000 1043 2254 1 chr1D.!!$F1 1211
10 TraesCS7D01G129200 chr1A 532361540 532363908 2368 False 456.000000 806 80.099000 992 3223 2 chr1A.!!$F1 2231
11 TraesCS7D01G129200 chr1B 587268006 587268752 746 False 459.000000 459 78.403000 992 1731 1 chr1B.!!$F1 739
12 TraesCS7D01G129200 chr1B 587273909 587275493 1584 False 205.300000 453 84.420333 1741 3223 3 chr1B.!!$F2 1482

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1562 1616 1.945354 GCCTCGTTCCAGGTCATCGA 61.945 60.0 0.0 0.0 35.72 3.59 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2445 2601 5.822584 GCAATTTGCACAGGTAGTTAAAC 57.177 39.13 16.35 0.0 44.26 2.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1562 1616 1.945354 GCCTCGTTCCAGGTCATCGA 61.945 60.000 0.00 0.00 35.72 3.59
2445 2601 7.484975 AGTTTCTACTTTGGTCGATCTAGATG 58.515 38.462 10.74 2.97 0.00 2.90
2672 2870 7.720074 CCTACCAGTTTCCTAGATTATTTTCCC 59.280 40.741 0.00 0.00 0.00 3.97
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1562 1616 2.040606 AGGGGTCGGGCTGTATGT 59.959 61.111 0.00 0.0 0.00 2.29
1848 1925 3.127533 GACACGATGCACAGCCCC 61.128 66.667 0.00 0.0 0.00 5.80
2445 2601 5.822584 GCAATTTGCACAGGTAGTTAAAC 57.177 39.130 16.35 0.0 44.26 2.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.