Multiple sequence alignment - TraesCS7D01G125400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G125400 chr7D 100.000 5063 0 0 1 5063 78421278 78416216 0.000000e+00 9350
1 TraesCS7D01G125400 chr4D 98.798 5076 40 8 1 5063 472492247 472487180 0.000000e+00 9016
2 TraesCS7D01G125400 chr4D 88.342 549 25 10 3233 3768 30898776 30898254 1.550000e-174 623
3 TraesCS7D01G125400 chr4D 81.163 860 71 33 3846 4636 30898232 30897395 1.560000e-169 606
4 TraesCS7D01G125400 chr4D 88.235 255 22 6 4695 4943 30897396 30897144 1.070000e-76 298
5 TraesCS7D01G125400 chr4D 84.884 258 27 10 1520 1770 30903226 30902974 3.030000e-62 250
6 TraesCS7D01G125400 chr4D 86.709 158 6 5 1321 1464 30921218 30921062 1.460000e-35 161
7 TraesCS7D01G125400 chr4D 94.393 107 2 4 4705 4809 449463751 449463647 1.460000e-35 161
8 TraesCS7D01G125400 chr4D 93.458 107 5 1 4705 4809 449462815 449462709 1.890000e-34 158
9 TraesCS7D01G125400 chr4B 92.165 1838 81 25 1040 2865 594848433 594846647 0.000000e+00 2538
10 TraesCS7D01G125400 chr4B 90.071 1128 74 21 3460 4555 594845950 594844829 0.000000e+00 1428
11 TraesCS7D01G125400 chr4B 89.149 470 32 10 531 988 594848901 594848439 7.360000e-158 568
12 TraesCS7D01G125400 chr4B 80.269 669 37 24 1 610 594849513 594848881 2.820000e-112 416
13 TraesCS7D01G125400 chr4B 81.495 535 39 27 2876 3368 594846605 594846089 7.950000e-103 385
14 TraesCS7D01G125400 chr4B 87.383 214 18 4 4643 4856 594844824 594844620 2.360000e-58 237
15 TraesCS7D01G125400 chr4B 87.151 179 11 3 4886 5063 594844384 594844217 5.170000e-45 193
16 TraesCS7D01G125400 chr4B 94.340 106 4 2 4705 4809 562056597 562056493 1.460000e-35 161
17 TraesCS7D01G125400 chr4A 90.817 1873 94 41 1039 2880 679259867 679258042 0.000000e+00 2435
18 TraesCS7D01G125400 chr4A 88.813 733 46 18 3368 4085 679257547 679256836 0.000000e+00 867
19 TraesCS7D01G125400 chr4A 87.097 434 19 17 571 975 679260304 679259879 1.660000e-124 457
20 TraesCS7D01G125400 chr4A 82.601 569 38 30 1 535 679260841 679260300 3.600000e-121 446
21 TraesCS7D01G125400 chr4A 84.750 400 44 11 4680 5063 679256645 679256247 7.950000e-103 385
22 TraesCS7D01G125400 chr4A 84.173 417 19 18 2877 3260 679258018 679257616 1.340000e-95 361
23 TraesCS7D01G125400 chr4A 78.182 220 33 12 4343 4548 679256842 679256624 5.320000e-25 126
24 TraesCS7D01G125400 chrUn 100.000 415 0 0 3910 4324 477287939 477288353 0.000000e+00 767
25 TraesCS7D01G125400 chr5A 89.619 289 30 0 3471 3759 650649432 650649144 8.010000e-98 368
26 TraesCS7D01G125400 chr5D 89.273 289 31 0 3471 3759 524449934 524449646 3.730000e-96 363
27 TraesCS7D01G125400 chr5B 88.927 289 32 0 3471 3759 658925668 658925380 1.730000e-94 357
28 TraesCS7D01G125400 chr7B 96.078 102 3 1 4709 4810 427706907 427706807 1.130000e-36 165
29 TraesCS7D01G125400 chr1D 94.231 104 6 0 4709 4812 379472688 379472585 5.250000e-35 159


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G125400 chr7D 78416216 78421278 5062 True 9350.000000 9350 100.000000 1 5063 1 chr7D.!!$R1 5062
1 TraesCS7D01G125400 chr4D 472487180 472492247 5067 True 9016.000000 9016 98.798000 1 5063 1 chr4D.!!$R3 5062
2 TraesCS7D01G125400 chr4D 30897144 30898776 1632 True 509.000000 623 85.913333 3233 4943 3 chr4D.!!$R4 1710
3 TraesCS7D01G125400 chr4B 594844217 594849513 5296 True 823.571429 2538 86.811857 1 5063 7 chr4B.!!$R2 5062
4 TraesCS7D01G125400 chr4A 679256247 679260841 4594 True 725.285714 2435 85.204714 1 5063 7 chr4A.!!$R1 5062

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
56 57 0.314935 CAAACACCTGCGCTTCCATT 59.685 50.000 9.73 0.0 0.0 3.16 F
405 481 0.549902 TTCCCTGCCTGATCCTTGGA 60.550 55.000 0.00 0.0 0.0 3.53 F
1466 1670 4.148825 GTCGCCGCCTCCATCAGT 62.149 66.667 0.00 0.0 0.0 3.41 F
2796 3011 0.824109 CCTCAGCTACAACCGGATCA 59.176 55.000 9.46 0.0 0.0 2.92 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1368 1572 1.074872 GCGTACGGAACCTTCTTCGG 61.075 60.000 18.39 0.0 0.0 4.30 R
1466 1670 4.680237 CAGCCGACACCGCCTTGA 62.680 66.667 0.00 0.0 0.0 3.02 R
2871 3088 0.742505 CGTAGTACTGGAATGGGCGA 59.257 55.000 5.39 0.0 0.0 5.54 R
4780 5239 3.427773 CGACCTTAGCTCAGTTGGTAGAC 60.428 52.174 0.00 0.0 0.0 2.59 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
56 57 0.314935 CAAACACCTGCGCTTCCATT 59.685 50.000 9.73 0.0 0.00 3.16
321 397 2.359107 CAGCCACACACATCGCCT 60.359 61.111 0.00 0.0 0.00 5.52
405 481 0.549902 TTCCCTGCCTGATCCTTGGA 60.550 55.000 0.00 0.0 0.00 3.53
1466 1670 4.148825 GTCGCCGCCTCCATCAGT 62.149 66.667 0.00 0.0 0.00 3.41
2796 3011 0.824109 CCTCAGCTACAACCGGATCA 59.176 55.000 9.46 0.0 0.00 2.92
3107 3391 0.248094 GATGAGCGTCGTGTCATCGA 60.248 55.000 18.13 0.0 39.70 3.59
3186 3476 4.088823 ACATCTCGCATTCTGCTTTTTC 57.911 40.909 0.00 0.0 42.25 2.29
3361 3665 3.434319 CTGGGTGCCACATCGTGC 61.434 66.667 0.00 0.0 31.34 5.34
3908 4291 3.077556 GAGGGAAGGGAGCAGCGA 61.078 66.667 0.00 0.0 0.00 4.93
4334 4769 6.647895 TCAATTGTACTCCCTTCGTAAAGAAC 59.352 38.462 5.13 0.0 34.14 3.01
4766 5225 4.451900 ACCTAAGGATTTATCTGCAACGG 58.548 43.478 0.00 0.0 0.00 4.44
4780 5239 2.348888 AACGGCTACAGTCCTCCGG 61.349 63.158 0.00 0.0 45.58 5.14
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
321 397 4.451150 GCCGGTGTCGATGGAGCA 62.451 66.667 1.90 0.00 39.00 4.26
1368 1572 1.074872 GCGTACGGAACCTTCTTCGG 61.075 60.000 18.39 0.00 0.00 4.30
1466 1670 4.680237 CAGCCGACACCGCCTTGA 62.680 66.667 0.00 0.00 0.00 3.02
2871 3088 0.742505 CGTAGTACTGGAATGGGCGA 59.257 55.000 5.39 0.00 0.00 5.54
3107 3391 2.495866 CGGCGTATTGGTACCGGT 59.504 61.111 13.98 13.98 41.95 5.28
3361 3665 5.735354 GCAGGATCATAATTTTGCAGTGGAG 60.735 44.000 0.00 0.00 0.00 3.86
4334 4769 6.124088 AGCGCCAACTTCAAATTCTTATAG 57.876 37.500 2.29 0.00 0.00 1.31
4519 4978 8.202137 GCCAGTCTACCTCAGTAAAATAATGTA 58.798 37.037 0.00 0.00 0.00 2.29
4780 5239 3.427773 CGACCTTAGCTCAGTTGGTAGAC 60.428 52.174 0.00 0.00 0.00 2.59
4879 5351 2.924290 GTGCACGATCCTTTACTCTGAC 59.076 50.000 0.00 0.00 0.00 3.51
4884 5553 0.246635 AGCGTGCACGATCCTTTACT 59.753 50.000 41.19 22.92 43.02 2.24


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.