Multiple sequence alignment - TraesCS7D01G114900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G114900 chr7D 100.000 2465 0 0 1 2465 70680734 70678270 0.000000e+00 4553
1 TraesCS7D01G114900 chr7D 97.337 2103 36 3 366 2465 596122351 596120266 0.000000e+00 3555
2 TraesCS7D01G114900 chr7D 96.434 2103 62 4 366 2465 530866727 530864635 0.000000e+00 3456
3 TraesCS7D01G114900 chr7D 93.835 2125 68 17 366 2465 11642964 11645050 0.000000e+00 3140
4 TraesCS7D01G114900 chr7D 97.447 1567 37 2 902 2465 498406724 498408290 0.000000e+00 2669
5 TraesCS7D01G114900 chr7D 97.826 368 8 0 1 368 498405813 498406180 9.620000e-179 636
6 TraesCS7D01G114900 chr7D 97.011 368 11 0 1 368 530867223 530866856 9.680000e-174 619
7 TraesCS7D01G114900 chr7D 96.467 368 13 0 1 368 89090566 89090199 2.100000e-170 608
8 TraesCS7D01G114900 chr7D 96.467 368 12 1 1 368 596122846 596122480 7.540000e-170 606
9 TraesCS7D01G114900 chr7D 96.196 368 14 0 1 368 592401207 592401574 9.750000e-169 603
10 TraesCS7D01G114900 chr4D 96.159 2109 72 6 366 2465 440464725 440462617 0.000000e+00 3437
11 TraesCS7D01G114900 chr4D 97.011 368 11 0 1 368 440465221 440464854 9.680000e-174 619
12 TraesCS7D01G114900 chr4D 96.739 368 12 0 1 368 489196563 489196930 4.510000e-172 614
13 TraesCS7D01G114900 chr5D 97.351 1925 44 3 544 2465 351321021 351322941 0.000000e+00 3265
14 TraesCS7D01G114900 chr5D 96.530 1556 43 4 913 2465 443522613 443524160 0.000000e+00 2564
15 TraesCS7D01G114900 chr5D 97.011 368 11 0 1 368 443521486 443521853 9.680000e-174 619
16 TraesCS7D01G114900 chr5D 96.467 368 13 0 1 368 351308906 351309273 2.100000e-170 608
17 TraesCS7D01G114900 chr6A 93.355 2107 104 9 366 2465 508298911 508300988 0.000000e+00 3083
18 TraesCS7D01G114900 chr6A 96.622 444 15 0 366 809 134202434 134202877 0.000000e+00 737
19 TraesCS7D01G114900 chr1B 93.845 2047 90 15 424 2465 591153478 591155493 0.000000e+00 3049
20 TraesCS7D01G114900 chr5A 91.845 2146 95 28 366 2465 243926345 243928456 0.000000e+00 2920
21 TraesCS7D01G114900 chr7A 90.191 2151 89 49 366 2465 47491322 47489243 0.000000e+00 2691
22 TraesCS7D01G114900 chr6B 91.381 1137 48 16 1347 2464 164399432 164398327 0.000000e+00 1511
23 TraesCS7D01G114900 chr6B 90.122 1144 51 24 1350 2465 650755238 650756347 0.000000e+00 1430
24 TraesCS7D01G114900 chr5B 98.347 121 2 0 844 964 71984704 71984824 1.920000e-51 213


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G114900 chr7D 70678270 70680734 2464 True 4553.0 4553 100.0000 1 2465 1 chr7D.!!$R1 2464
1 TraesCS7D01G114900 chr7D 11642964 11645050 2086 False 3140.0 3140 93.8350 366 2465 1 chr7D.!!$F1 2099
2 TraesCS7D01G114900 chr7D 596120266 596122846 2580 True 2080.5 3555 96.9020 1 2465 2 chr7D.!!$R4 2464
3 TraesCS7D01G114900 chr7D 530864635 530867223 2588 True 2037.5 3456 96.7225 1 2465 2 chr7D.!!$R3 2464
4 TraesCS7D01G114900 chr7D 498405813 498408290 2477 False 1652.5 2669 97.6365 1 2465 2 chr7D.!!$F3 2464
5 TraesCS7D01G114900 chr4D 440462617 440465221 2604 True 2028.0 3437 96.5850 1 2465 2 chr4D.!!$R1 2464
6 TraesCS7D01G114900 chr5D 351321021 351322941 1920 False 3265.0 3265 97.3510 544 2465 1 chr5D.!!$F2 1921
7 TraesCS7D01G114900 chr5D 443521486 443524160 2674 False 1591.5 2564 96.7705 1 2465 2 chr5D.!!$F3 2464
8 TraesCS7D01G114900 chr6A 508298911 508300988 2077 False 3083.0 3083 93.3550 366 2465 1 chr6A.!!$F2 2099
9 TraesCS7D01G114900 chr1B 591153478 591155493 2015 False 3049.0 3049 93.8450 424 2465 1 chr1B.!!$F1 2041
10 TraesCS7D01G114900 chr5A 243926345 243928456 2111 False 2920.0 2920 91.8450 366 2465 1 chr5A.!!$F1 2099
11 TraesCS7D01G114900 chr7A 47489243 47491322 2079 True 2691.0 2691 90.1910 366 2465 1 chr7A.!!$R1 2099
12 TraesCS7D01G114900 chr6B 164398327 164399432 1105 True 1511.0 1511 91.3810 1347 2464 1 chr6B.!!$R1 1117
13 TraesCS7D01G114900 chr6B 650755238 650756347 1109 False 1430.0 1430 90.1220 1350 2465 1 chr6B.!!$F1 1115

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
599 731 2.296471 ACTGAACCTGAGAACACCTACG 59.704 50.0 0.0 0.0 0.0 3.51 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2331 2702 0.037882 ACGACTCTGACGACGAGGTA 60.038 55.0 0.0 0.0 32.83 3.08 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
51 52 3.515630 CAATAAGTGAGAGCGAGCTCAA 58.484 45.455 24.70 11.39 45.69 3.02
554 686 8.580720 TGGAAGCTATATGTGAAAGTAGATCTC 58.419 37.037 0.00 0.00 0.00 2.75
599 731 2.296471 ACTGAACCTGAGAACACCTACG 59.704 50.000 0.00 0.00 0.00 3.51
1071 1303 1.133809 AGGAGGTGGCCAAGCTACAA 61.134 55.000 7.24 0.00 41.80 2.41
1758 1992 6.353404 TCATGTGTGGATAACTGACAGTAA 57.647 37.500 8.91 0.00 0.00 2.24
2059 2421 2.878406 GCACTGAAGTAACTGAAGGCAA 59.122 45.455 0.00 0.00 0.00 4.52
2079 2441 4.279420 GCAACACTTCAATCCTCCTTCTTT 59.721 41.667 0.00 0.00 0.00 2.52
2266 2637 1.764854 TTCCTATCCCCCTCCACGC 60.765 63.158 0.00 0.00 0.00 5.34
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
51 52 0.885196 GAAGAGACTGAGCGAGTGGT 59.115 55.000 0.00 0.00 33.83 4.16
314 315 5.040635 TCGAATCAAACCAAAAGCAACTTC 58.959 37.500 0.00 0.00 0.00 3.01
358 359 1.269958 ATACCTGCTGCACTGTCAGA 58.730 50.000 6.91 0.00 36.19 3.27
599 731 5.574830 CACAGTACACTAAAGATCTCTGCAC 59.425 44.000 0.00 0.00 0.00 4.57
734 883 2.371841 ACACCACCTGACTTAGCATCAA 59.628 45.455 0.00 0.00 0.00 2.57
1512 1746 2.811410 ACATGCATGACATTCCAAGGT 58.189 42.857 32.75 2.76 36.64 3.50
1758 1992 6.054860 ACTTGCTACTTCCAACTATGTCAT 57.945 37.500 0.00 0.00 0.00 3.06
1873 2142 8.298729 TGAATGGCAGTACTATCTATCTATGG 57.701 38.462 0.00 0.00 0.00 2.74
2059 2421 5.221925 TGCTAAAGAAGGAGGATTGAAGTGT 60.222 40.000 0.00 0.00 0.00 3.55
2067 2429 5.163216 CCTGAAGATGCTAAAGAAGGAGGAT 60.163 44.000 0.00 0.00 0.00 3.24
2079 2441 1.144716 CCAGCGCCTGAAGATGCTA 59.855 57.895 2.29 0.00 35.56 3.49
2266 2637 3.827898 GGCTCCAGTCCTCGACGG 61.828 72.222 0.00 0.00 37.67 4.79
2277 2648 2.281970 CTGCAGTTGCTGGCTCCA 60.282 61.111 5.25 0.00 42.66 3.86
2288 2659 1.005630 GACGAGCCTGAACTGCAGT 60.006 57.895 15.25 15.25 43.33 4.40
2331 2702 0.037882 ACGACTCTGACGACGAGGTA 60.038 55.000 0.00 0.00 32.83 3.08
2371 2752 1.947013 GACGACGAGTCCAGTGACA 59.053 57.895 0.00 0.00 44.33 3.58


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.