Multiple sequence alignment - TraesCS7D01G099400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G099400 chr7D 100.000 3109 0 0 1 3109 59692757 59689649 0.000000e+00 5742
1 TraesCS7D01G099400 chr7D 92.066 542 33 3 686 1218 79046620 79046080 0.000000e+00 754
2 TraesCS7D01G099400 chr6D 96.643 3128 86 10 1 3109 343521704 343524831 0.000000e+00 5177
3 TraesCS7D01G099400 chr6D 87.008 254 25 4 1 246 227008030 227008283 2.360000e-71 279
4 TraesCS7D01G099400 chr6D 85.771 253 29 5 1 246 388724532 388724280 8.550000e-66 261
5 TraesCS7D01G099400 chr6D 84.585 253 32 4 1 246 398868768 398869020 8.610000e-61 244
6 TraesCS7D01G099400 chr6D 84.462 251 32 3 3 246 321922992 321923242 1.110000e-59 241
7 TraesCS7D01G099400 chr5D 96.035 3127 105 5 1 3109 170710569 170713694 0.000000e+00 5070
8 TraesCS7D01G099400 chr2D 95.301 3128 84 11 1 3109 621171302 621168219 0.000000e+00 4903
9 TraesCS7D01G099400 chr2D 87.342 237 23 3 1 230 481947640 481947404 6.610000e-67 265
10 TraesCS7D01G099400 chr3D 96.916 2886 69 8 244 3109 482587959 482590844 0.000000e+00 4819
11 TraesCS7D01G099400 chr6A 94.135 2762 120 9 296 3037 298324286 298327025 0.000000e+00 4165
12 TraesCS7D01G099400 chr6A 87.984 491 34 14 1222 1698 73682112 73681633 9.740000e-155 556
13 TraesCS7D01G099400 chr5B 96.638 1963 61 5 1151 3109 658347010 658348971 0.000000e+00 3254
14 TraesCS7D01G099400 chr5B 91.721 1075 68 5 163 1218 290877254 290878326 0.000000e+00 1472
15 TraesCS7D01G099400 chr5B 88.993 1063 87 12 3 1038 658345946 658347005 0.000000e+00 1288
16 TraesCS7D01G099400 chr5B 88.164 659 64 10 1 649 17593058 17593712 0.000000e+00 773
17 TraesCS7D01G099400 chr6B 96.026 1963 70 6 1151 3109 651661139 651659181 0.000000e+00 3186
18 TraesCS7D01G099400 chr6B 89.567 1246 98 14 1 1218 396295828 396297069 0.000000e+00 1552
19 TraesCS7D01G099400 chr6B 89.024 1066 85 13 1 1038 651662205 651661144 0.000000e+00 1291
20 TraesCS7D01G099400 chr6B 87.664 916 91 16 1 914 245117494 245116599 0.000000e+00 1046
21 TraesCS7D01G099400 chr1B 95.825 1964 73 6 1151 3109 198113642 198111683 0.000000e+00 3164
22 TraesCS7D01G099400 chr1B 95.904 1953 74 6 1151 3100 149121727 149119778 0.000000e+00 3158
23 TraesCS7D01G099400 chr1B 89.024 1066 84 14 1 1038 198114707 198113647 0.000000e+00 1290
24 TraesCS7D01G099400 chr1B 88.826 1065 89 13 1 1038 149122793 149121732 0.000000e+00 1280
25 TraesCS7D01G099400 chr1B 88.146 658 66 8 1 649 472253682 472254336 0.000000e+00 773
26 TraesCS7D01G099400 chr1B 85.827 254 29 3 1 247 543456490 543456743 2.380000e-66 263
27 TraesCS7D01G099400 chr1A 90.048 1246 91 13 1 1218 365221006 365222246 0.000000e+00 1583
28 TraesCS7D01G099400 chr2B 89.701 1136 74 15 123 1218 86850189 86849057 0.000000e+00 1410
29 TraesCS7D01G099400 chr7B 90.868 438 29 4 792 1218 154766027 154766464 7.480000e-161 577
30 TraesCS7D01G099400 chr2A 88.312 308 29 3 1 301 616942591 616942284 2.280000e-96 363
31 TraesCS7D01G099400 chr4D 83.858 254 34 5 1 247 237956140 237955887 5.180000e-58 235


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G099400 chr7D 59689649 59692757 3108 True 5742.0 5742 100.0000 1 3109 1 chr7D.!!$R1 3108
1 TraesCS7D01G099400 chr7D 79046080 79046620 540 True 754.0 754 92.0660 686 1218 1 chr7D.!!$R2 532
2 TraesCS7D01G099400 chr6D 343521704 343524831 3127 False 5177.0 5177 96.6430 1 3109 1 chr6D.!!$F3 3108
3 TraesCS7D01G099400 chr5D 170710569 170713694 3125 False 5070.0 5070 96.0350 1 3109 1 chr5D.!!$F1 3108
4 TraesCS7D01G099400 chr2D 621168219 621171302 3083 True 4903.0 4903 95.3010 1 3109 1 chr2D.!!$R2 3108
5 TraesCS7D01G099400 chr3D 482587959 482590844 2885 False 4819.0 4819 96.9160 244 3109 1 chr3D.!!$F1 2865
6 TraesCS7D01G099400 chr6A 298324286 298327025 2739 False 4165.0 4165 94.1350 296 3037 1 chr6A.!!$F1 2741
7 TraesCS7D01G099400 chr5B 658345946 658348971 3025 False 2271.0 3254 92.8155 3 3109 2 chr5B.!!$F3 3106
8 TraesCS7D01G099400 chr5B 290877254 290878326 1072 False 1472.0 1472 91.7210 163 1218 1 chr5B.!!$F2 1055
9 TraesCS7D01G099400 chr5B 17593058 17593712 654 False 773.0 773 88.1640 1 649 1 chr5B.!!$F1 648
10 TraesCS7D01G099400 chr6B 651659181 651662205 3024 True 2238.5 3186 92.5250 1 3109 2 chr6B.!!$R2 3108
11 TraesCS7D01G099400 chr6B 396295828 396297069 1241 False 1552.0 1552 89.5670 1 1218 1 chr6B.!!$F1 1217
12 TraesCS7D01G099400 chr6B 245116599 245117494 895 True 1046.0 1046 87.6640 1 914 1 chr6B.!!$R1 913
13 TraesCS7D01G099400 chr1B 198111683 198114707 3024 True 2227.0 3164 92.4245 1 3109 2 chr1B.!!$R2 3108
14 TraesCS7D01G099400 chr1B 149119778 149122793 3015 True 2219.0 3158 92.3650 1 3100 2 chr1B.!!$R1 3099
15 TraesCS7D01G099400 chr1B 472253682 472254336 654 False 773.0 773 88.1460 1 649 1 chr1B.!!$F1 648
16 TraesCS7D01G099400 chr1A 365221006 365222246 1240 False 1583.0 1583 90.0480 1 1218 1 chr1A.!!$F1 1217
17 TraesCS7D01G099400 chr2B 86849057 86850189 1132 True 1410.0 1410 89.7010 123 1218 1 chr2B.!!$R1 1095

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
225 233 0.755327 AACGGCCACTTTCTTTGCCT 60.755 50.0 2.24 0.0 41.80 4.75 F
1333 1382 0.622665 CCAAGCTGGATGAGACCCTT 59.377 55.0 0.00 0.0 40.96 3.95 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1348 1397 1.023513 GCCGAAGCAGTGCTCTGAAT 61.024 55.000 20.03 1.04 43.76 2.57 R
2657 2720 3.511477 ACAGCTCTAAGAGAAGGAACCA 58.489 45.455 0.00 0.00 0.00 3.67 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
225 233 0.755327 AACGGCCACTTTCTTTGCCT 60.755 50.000 2.24 0.0 41.80 4.75
276 284 5.018695 AGCAGACGACAAAGAAAATAACG 57.981 39.130 0.00 0.0 0.00 3.18
399 407 1.210478 CCACGTTGGATCCCATCTCTT 59.790 52.381 9.90 0.0 40.96 2.85
505 513 2.760385 GAGGTCACCTCTCCCCGG 60.760 72.222 17.52 0.0 46.41 5.73
718 758 1.153823 CTCGACCAACGGCGAGATT 60.154 57.895 16.62 0.0 45.13 2.40
858 898 1.229082 AACCCCACGAGTAGCCTCA 60.229 57.895 0.00 0.0 37.59 3.86
1333 1382 0.622665 CCAAGCTGGATGAGACCCTT 59.377 55.000 0.00 0.0 40.96 3.95
1449 1498 6.425721 TGACTAGTTATGTGGTACAAGCAAAC 59.574 38.462 0.00 0.0 44.16 2.93
1767 1824 2.444624 CGTTGTCAGGATGGTCGCG 61.445 63.158 0.00 0.0 36.16 5.87
2241 2300 5.394224 ACTAGCTACTGAACTTCTTGGAC 57.606 43.478 0.00 0.0 0.00 4.02
2242 2301 3.686916 AGCTACTGAACTTCTTGGACC 57.313 47.619 0.00 0.0 0.00 4.46
2400 2461 2.809861 AAGGACGCTGCATCCAGGTG 62.810 60.000 17.87 0.0 38.86 4.00
2657 2720 0.324943 AGCGCCTCTTGTTGTACCAT 59.675 50.000 2.29 0.0 0.00 3.55
3081 3146 2.881827 CCGTCGCGGTCGCAAATA 60.882 61.111 15.68 0.0 42.73 1.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
111 112 2.558313 GCAAAGAGCACGCTGACC 59.442 61.111 0.00 0.00 44.79 4.02
399 407 0.033405 AGGGGATCGAGGAAGACGAA 60.033 55.000 0.00 0.00 42.80 3.85
505 513 1.218316 GGTCGGTGGAGATGGTGAC 59.782 63.158 0.00 0.00 0.00 3.67
858 898 0.824759 GTGACGAGGAACTAGGCCAT 59.175 55.000 5.01 0.00 38.77 4.40
1348 1397 1.023513 GCCGAAGCAGTGCTCTGAAT 61.024 55.000 20.03 1.04 43.76 2.57
1449 1498 3.982475 TGAGCTAGCTAATGAATGTCGG 58.018 45.455 19.38 0.00 0.00 4.79
1683 1740 2.355209 GGCCTCCTCTAAACAAGACTGG 60.355 54.545 0.00 0.00 0.00 4.00
1752 1809 4.451150 GCCGCGACCATCCTGACA 62.451 66.667 8.23 0.00 0.00 3.58
1767 1824 1.740025 CGTTGAGAATCTTGAAGGGCC 59.260 52.381 0.00 0.00 34.92 5.80
2400 2461 4.793201 AGCAAGGACTAATTATTCCCACC 58.207 43.478 16.16 6.67 31.51 4.61
2657 2720 3.511477 ACAGCTCTAAGAGAAGGAACCA 58.489 45.455 0.00 0.00 0.00 3.67
3081 3146 4.040461 ACTCCACAAGCACACTACATACTT 59.960 41.667 0.00 0.00 0.00 2.24


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.