Multiple sequence alignment - TraesCS7D01G095300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G095300 chr7D 100.000 3662 0 0 1 3662 58108629 58112290 0.000000e+00 6763.0
1 TraesCS7D01G095300 chr7D 96.860 3663 111 4 1 3662 127416964 127413305 0.000000e+00 6124.0
2 TraesCS7D01G095300 chr2D 98.580 3662 47 1 1 3662 345274982 345271326 0.000000e+00 6469.0
3 TraesCS7D01G095300 chr2D 98.198 3662 56 3 1 3662 639464302 639467953 0.000000e+00 6388.0
4 TraesCS7D01G095300 chr1D 98.498 3662 55 0 1 3662 71308016 71304355 0.000000e+00 6458.0
5 TraesCS7D01G095300 chr2A 92.884 3668 239 11 1 3662 32135383 32131732 0.000000e+00 5308.0
6 TraesCS7D01G095300 chr1A 93.491 3165 196 8 1 3160 546526287 546523128 0.000000e+00 4695.0
7 TraesCS7D01G095300 chr5D 98.940 2075 22 0 1 2075 42224958 42222884 0.000000e+00 3711.0
8 TraesCS7D01G095300 chr5D 97.527 1456 35 1 2207 3662 42222895 42221441 0.000000e+00 2488.0
9 TraesCS7D01G095300 chr4D 79.141 1443 267 25 1 1423 508533515 508532087 0.000000e+00 966.0
10 TraesCS7D01G095300 chr3A 80.836 694 111 18 1 676 541220747 541221436 3.240000e-145 525.0
11 TraesCS7D01G095300 chr6B 81.789 626 99 11 1 613 669533015 669533638 9.070000e-141 510.0
12 TraesCS7D01G095300 chr7B 91.753 97 8 0 1 97 558313635 558313539 6.380000e-28 135.0
13 TraesCS7D01G095300 chr7B 75.573 131 30 2 1279 1408 718427367 718427238 3.050000e-06 63.9
14 TraesCS7D01G095300 chr4A 77.863 131 27 2 1279 1408 117097621 117097492 3.030000e-11 80.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G095300 chr7D 58108629 58112290 3661 False 6763.0 6763 100.0000 1 3662 1 chr7D.!!$F1 3661
1 TraesCS7D01G095300 chr7D 127413305 127416964 3659 True 6124.0 6124 96.8600 1 3662 1 chr7D.!!$R1 3661
2 TraesCS7D01G095300 chr2D 345271326 345274982 3656 True 6469.0 6469 98.5800 1 3662 1 chr2D.!!$R1 3661
3 TraesCS7D01G095300 chr2D 639464302 639467953 3651 False 6388.0 6388 98.1980 1 3662 1 chr2D.!!$F1 3661
4 TraesCS7D01G095300 chr1D 71304355 71308016 3661 True 6458.0 6458 98.4980 1 3662 1 chr1D.!!$R1 3661
5 TraesCS7D01G095300 chr2A 32131732 32135383 3651 True 5308.0 5308 92.8840 1 3662 1 chr2A.!!$R1 3661
6 TraesCS7D01G095300 chr1A 546523128 546526287 3159 True 4695.0 4695 93.4910 1 3160 1 chr1A.!!$R1 3159
7 TraesCS7D01G095300 chr5D 42221441 42224958 3517 True 3099.5 3711 98.2335 1 3662 2 chr5D.!!$R1 3661
8 TraesCS7D01G095300 chr4D 508532087 508533515 1428 True 966.0 966 79.1410 1 1423 1 chr4D.!!$R1 1422
9 TraesCS7D01G095300 chr3A 541220747 541221436 689 False 525.0 525 80.8360 1 676 1 chr3A.!!$F1 675
10 TraesCS7D01G095300 chr6B 669533015 669533638 623 False 510.0 510 81.7890 1 613 1 chr6B.!!$F1 612

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
631 653 0.389426 ACGAAGAAAGCCGCATACGT 60.389 50.000 0.00 0.0 37.70 3.57 F
665 687 2.045242 CTGGTGCCAGCAGAGCAT 60.045 61.111 18.82 0.0 45.98 3.79 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2270 2344 2.837591 TCACCAATAGCACTGCCTTCTA 59.162 45.455 0.00 0.0 0.0 2.10 R
2897 2971 3.129502 CACAGCTGGCATCCACGG 61.130 66.667 19.93 0.0 0.0 4.94 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
443 465 9.311916 GCATTGGCAAAGTTTACAATATAATCA 57.688 29.630 3.01 0.0 40.72 2.57
631 653 0.389426 ACGAAGAAAGCCGCATACGT 60.389 50.000 0.00 0.0 37.70 3.57
665 687 2.045242 CTGGTGCCAGCAGAGCAT 60.045 61.111 18.82 0.0 45.98 3.79
2270 2344 4.065088 ACGAACAGCAATACAAGTGATGT 58.935 39.130 0.00 0.0 47.00 3.06
2508 2582 1.571460 CACAACTTGTCCGCAGAGC 59.429 57.895 0.00 0.0 0.00 4.09
2839 2913 7.443259 TTTTTCTGTAAGTTTATTCTCCCGG 57.557 36.000 0.00 0.0 33.76 5.73
2888 2962 2.289820 CTCGCATGCAGCATTAACATCT 59.710 45.455 19.57 0.0 46.13 2.90
2897 2971 5.210715 GCAGCATTAACATCTTATCACTGC 58.789 41.667 0.00 0.0 39.85 4.40
3273 3348 3.068064 TCGAGCGGCAGTGATCCA 61.068 61.111 1.45 0.0 0.00 3.41
3499 3574 4.866921 TGAAGTCGAATCTCGTCTTTCAA 58.133 39.130 9.32 0.0 45.25 2.69
3550 3625 3.507622 AGAAGAACATGTTTTAGCTGGCC 59.492 43.478 13.36 0.0 0.00 5.36
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
443 465 4.214332 GCTCATTGAACCGAAGAAACTTCT 59.786 41.667 9.31 0.0 39.74 2.85
631 653 4.941263 GCACCAGTTGACCATAACAGATTA 59.059 41.667 0.00 0.0 33.02 1.75
665 687 7.949690 TTGCATCTCCAAAGTAGTAGTACTA 57.050 36.000 10.68 5.9 38.66 1.82
1526 1592 3.843619 TCATTCTCATTACAGGGGACACA 59.156 43.478 0.00 0.0 0.00 3.72
2270 2344 2.837591 TCACCAATAGCACTGCCTTCTA 59.162 45.455 0.00 0.0 0.00 2.10
2897 2971 3.129502 CACAGCTGGCATCCACGG 61.130 66.667 19.93 0.0 0.00 4.94
3400 3475 3.199508 ACTGATTCCTACATGCAGAAGCT 59.800 43.478 8.93 0.0 42.74 3.74
3499 3574 1.043673 GTAGCCATCCCCTCGACAGT 61.044 60.000 0.00 0.0 0.00 3.55
3550 3625 0.591170 GTGTTTGTGGGGTCGTCATG 59.409 55.000 0.00 0.0 0.00 3.07


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.