Multiple sequence alignment - TraesCS7D01G081400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G081400 chr7D 100.000 2593 0 0 1 2593 48208764 48211356 0.000000e+00 4789.0
1 TraesCS7D01G081400 chr7D 97.263 2594 50 8 1 2592 48172742 48175316 0.000000e+00 4377.0
2 TraesCS7D01G081400 chr7D 97.187 2595 52 7 1 2593 48165755 48168330 0.000000e+00 4368.0
3 TraesCS7D01G081400 chr7D 96.765 2597 59 11 1 2593 48126806 48129381 0.000000e+00 4307.0
4 TraesCS7D01G081400 chr7D 92.468 1487 77 17 571 2053 48257036 48258491 0.000000e+00 2093.0
5 TraesCS7D01G081400 chr7D 81.718 908 131 18 872 1773 47809298 47808420 0.000000e+00 725.0
6 TraesCS7D01G081400 chr7D 86.806 144 10 6 592 729 48254641 48254781 4.470000e-33 152.0
7 TraesCS7D01G081400 chr7A 90.926 1620 82 31 571 2183 50633249 50634810 0.000000e+00 2117.0
8 TraesCS7D01G081400 chr7A 80.286 908 141 19 872 1773 50425652 50424777 0.000000e+00 651.0
9 TraesCS7D01G081400 chr7A 89.663 416 32 5 2189 2593 50816851 50816436 1.060000e-143 520.0
10 TraesCS7D01G081400 chr7A 80.871 643 100 18 1011 1635 9976756 9977393 3.880000e-133 484.0
11 TraesCS7D01G081400 chr7A 88.221 416 32 9 2189 2593 50791450 50791859 5.020000e-132 481.0
12 TraesCS7D01G081400 chr7A 87.500 56 1 6 825 880 71037008 71036959 2.790000e-05 60.2
13 TraesCS7D01G081400 chrUn 88.332 1637 114 34 571 2196 49485309 49486879 0.000000e+00 1893.0
14 TraesCS7D01G081400 chrUn 86.996 1638 113 35 571 2196 49452720 49454269 0.000000e+00 1753.0
15 TraesCS7D01G081400 chrUn 97.783 406 9 0 1742 2147 478115711 478116116 0.000000e+00 701.0
16 TraesCS7D01G081400 chrUn 94.177 395 20 3 2201 2593 49462385 49462778 1.330000e-167 599.0
17 TraesCS7D01G081400 chr4A 93.585 795 46 2 1073 1863 663211687 663212480 0.000000e+00 1181.0
18 TraesCS7D01G081400 chr4A 91.994 712 42 6 1883 2593 663212471 663213168 0.000000e+00 985.0
19 TraesCS7D01G081400 chr4A 93.958 480 24 4 571 1046 663211209 663211687 0.000000e+00 721.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G081400 chr7D 48208764 48211356 2592 False 4789.000000 4789 100.000 1 2593 1 chr7D.!!$F4 2592
1 TraesCS7D01G081400 chr7D 48172742 48175316 2574 False 4377.000000 4377 97.263 1 2592 1 chr7D.!!$F3 2591
2 TraesCS7D01G081400 chr7D 48165755 48168330 2575 False 4368.000000 4368 97.187 1 2593 1 chr7D.!!$F2 2592
3 TraesCS7D01G081400 chr7D 48126806 48129381 2575 False 4307.000000 4307 96.765 1 2593 1 chr7D.!!$F1 2592
4 TraesCS7D01G081400 chr7D 48254641 48258491 3850 False 1122.500000 2093 89.637 571 2053 2 chr7D.!!$F5 1482
5 TraesCS7D01G081400 chr7D 47808420 47809298 878 True 725.000000 725 81.718 872 1773 1 chr7D.!!$R1 901
6 TraesCS7D01G081400 chr7A 50633249 50634810 1561 False 2117.000000 2117 90.926 571 2183 1 chr7A.!!$F2 1612
7 TraesCS7D01G081400 chr7A 50424777 50425652 875 True 651.000000 651 80.286 872 1773 1 chr7A.!!$R1 901
8 TraesCS7D01G081400 chr7A 9976756 9977393 637 False 484.000000 484 80.871 1011 1635 1 chr7A.!!$F1 624
9 TraesCS7D01G081400 chrUn 49485309 49486879 1570 False 1893.000000 1893 88.332 571 2196 1 chrUn.!!$F3 1625
10 TraesCS7D01G081400 chrUn 49452720 49454269 1549 False 1753.000000 1753 86.996 571 2196 1 chrUn.!!$F1 1625
11 TraesCS7D01G081400 chr4A 663211209 663213168 1959 False 962.333333 1181 93.179 571 2593 3 chr4A.!!$F1 2022

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
552 553 0.036164 TCATGGAACCGTCACCCAAG 59.964 55.0 0.0 0.0 33.15 3.61 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1636 3524 0.171231 GGAAACATGCGGGCTTTCTC 59.829 55.0 0.0 0.0 0.0 2.87 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
115 116 1.447838 CCCTTGATCGGACACCACG 60.448 63.158 0.00 0.00 0.00 4.94
159 160 7.279615 TCATACCTTCCACATATACTGGTTTG 58.720 38.462 0.00 0.00 0.00 2.93
348 349 5.667466 ACTAGGTGGTTGTATTACGAATGG 58.333 41.667 0.00 0.00 0.00 3.16
408 409 1.606668 GAGCGGTCTCGAGATCAATCT 59.393 52.381 24.78 17.19 40.50 2.40
502 503 0.683412 GGTTTACCAGGAGTCACCGT 59.317 55.000 0.00 0.00 44.74 4.83
552 553 0.036164 TCATGGAACCGTCACCCAAG 59.964 55.000 0.00 0.00 33.15 3.61
790 2625 6.665992 TCTACACAGTTACAATCTTGACCT 57.334 37.500 0.00 0.00 0.00 3.85
1359 3247 3.684305 CGCTACCATCATCAACTCAACAA 59.316 43.478 0.00 0.00 0.00 2.83
1499 3387 0.601046 CGAAGAGTGAGTGCCTGCAA 60.601 55.000 0.00 0.00 0.00 4.08
1545 3433 1.079127 CCACCTTCATCGCGGTCTT 60.079 57.895 6.13 0.00 0.00 3.01
1567 3455 7.449704 GTCTTTGGGATAGAATTCCATATGCTT 59.550 37.037 0.65 0.00 37.53 3.91
1636 3524 6.538381 GGGCAATTAGGTTCCAATTAAACATG 59.462 38.462 0.00 0.00 0.00 3.21
1659 3553 3.361977 GCCCGCATGTTTCCGTGT 61.362 61.111 0.00 0.00 0.00 4.49
2129 4039 2.095059 ACGACAACCCACGTGTCTATAC 60.095 50.000 15.65 1.14 42.68 1.47
2464 4383 9.664332 CCATTATTTCATTAAATTGTCCAACCA 57.336 29.630 0.00 0.00 36.67 3.67
2478 4397 5.504853 TGTCCAACCATGATACTTTGCATA 58.495 37.500 0.00 0.00 0.00 3.14
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
408 409 3.129300 CCTCGGCGATCCTTGCTA 58.871 61.111 11.27 0.00 0.00 3.49
502 503 1.056660 GCGATTCCCAGGGGATTCTA 58.943 55.000 21.02 3.74 44.74 2.10
552 553 1.332889 ATCCTTAACCCGTCCGTCCC 61.333 60.000 0.00 0.00 0.00 4.46
779 2614 4.383649 CGTTGATTTTGCAGGTCAAGATTG 59.616 41.667 9.78 0.00 35.84 2.67
790 2625 0.825425 TGGAGGCCGTTGATTTTGCA 60.825 50.000 0.00 0.00 0.00 4.08
1307 3195 1.159713 TGTTCGCCGCATGATCATCC 61.160 55.000 4.86 0.00 0.00 3.51
1359 3247 1.257743 TTCTTGCTCTCGCCTACAGT 58.742 50.000 0.00 0.00 34.43 3.55
1499 3387 2.159382 CCGTTGTAGGAATGGCACTTT 58.841 47.619 0.00 0.00 0.00 2.66
1545 3433 6.012113 CCAAGCATATGGAATTCTATCCCAA 58.988 40.000 7.68 0.00 43.54 4.12
1567 3455 0.824182 ACCGACGGGCAAATTTTCCA 60.824 50.000 20.00 0.00 36.48 3.53
1578 3466 1.667212 GTGCCTTTTATTACCGACGGG 59.333 52.381 20.00 0.00 40.11 5.28
1636 3524 0.171231 GGAAACATGCGGGCTTTCTC 59.829 55.000 0.00 0.00 0.00 2.87
1640 3534 2.282180 ACGGAAACATGCGGGCTT 60.282 55.556 0.00 0.00 0.00 4.35
1659 3553 9.087871 TCATCAAATTTTTCCTTGTTGGATCTA 57.912 29.630 0.00 0.00 45.68 1.98
1837 3732 1.419381 TGACTGTCAGCCCACAACTA 58.581 50.000 6.36 0.00 0.00 2.24
2342 4261 2.685388 TGAATCTCACAAAACGCAACCA 59.315 40.909 0.00 0.00 0.00 3.67
2464 4383 7.728847 TGCGTATTCTTATGCAAAGTATCAT 57.271 32.000 0.00 0.00 45.16 2.45
2504 4423 4.952071 TGTTGATTTCCAGGCAATTTGA 57.048 36.364 0.00 0.00 0.00 2.69


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.