Multiple sequence alignment - TraesCS7D01G081300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G081300 chr7D 100.000 2593 0 0 1 2593 48165755 48168347 0.000000e+00 4789.0
1 TraesCS7D01G081300 chr7D 99.691 2593 8 0 1 2593 48172742 48175334 0.000000e+00 4745.0
2 TraesCS7D01G081300 chr7D 97.167 2612 53 7 1 2593 48208764 48211373 0.000000e+00 4394.0
3 TraesCS7D01G081300 chr7D 96.664 2608 57 10 1 2593 48126806 48129398 0.000000e+00 4307.0
4 TraesCS7D01G081300 chr7D 92.742 1488 72 20 570 2053 48257036 48258491 0.000000e+00 2117.0
5 TraesCS7D01G081300 chr7D 100.000 33 0 0 2050 2082 48258549 48258581 7.750000e-06 62.1
6 TraesCS7D01G081300 chr7A 91.049 1620 83 33 570 2186 50633249 50634809 0.000000e+00 2132.0
7 TraesCS7D01G081300 chr7A 89.401 434 36 5 2170 2593 50816852 50816419 2.940000e-149 538.0
8 TraesCS7D01G081300 chr7A 81.775 631 92 20 1011 1623 9976756 9977381 8.280000e-140 507.0
9 TraesCS7D01G081300 chr7A 88.018 434 36 8 2170 2593 50791449 50791876 1.390000e-137 499.0
10 TraesCS7D01G081300 chr7A 87.500 56 1 6 824 879 71037008 71036959 2.790000e-05 60.2
11 TraesCS7D01G081300 chrUn 88.793 1624 109 33 570 2183 49485309 49486869 0.000000e+00 1923.0
12 TraesCS7D01G081300 chrUn 87.346 1628 106 38 570 2186 49452720 49454258 0.000000e+00 1773.0
13 TraesCS7D01G081300 chrUn 100.000 406 0 0 1742 2147 478115711 478116116 0.000000e+00 750.0
14 TraesCS7D01G081300 chrUn 94.660 412 20 2 2183 2593 49462385 49462795 2.810000e-179 638.0
15 TraesCS7D01G081300 chr4A 94.340 795 40 2 1073 1863 663211687 663212480 0.000000e+00 1214.0
16 TraesCS7D01G081300 chr4A 91.747 727 32 9 1883 2593 663212471 663213185 0.000000e+00 985.0
17 TraesCS7D01G081300 chr4A 93.971 481 23 5 570 1046 663211209 663211687 0.000000e+00 723.0
18 TraesCS7D01G081300 chr4A 88.356 146 9 4 591 728 663210375 663210520 4.440000e-38 169.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G081300 chr7D 48165755 48168347 2592 False 4789.00 4789 100.0000 1 2593 1 chr7D.!!$F2 2592
1 TraesCS7D01G081300 chr7D 48172742 48175334 2592 False 4745.00 4745 99.6910 1 2593 1 chr7D.!!$F3 2592
2 TraesCS7D01G081300 chr7D 48208764 48211373 2609 False 4394.00 4394 97.1670 1 2593 1 chr7D.!!$F4 2592
3 TraesCS7D01G081300 chr7D 48126806 48129398 2592 False 4307.00 4307 96.6640 1 2593 1 chr7D.!!$F1 2592
4 TraesCS7D01G081300 chr7D 48257036 48258581 1545 False 1089.55 2117 96.3710 570 2082 2 chr7D.!!$F5 1512
5 TraesCS7D01G081300 chr7A 50633249 50634809 1560 False 2132.00 2132 91.0490 570 2186 1 chr7A.!!$F2 1616
6 TraesCS7D01G081300 chr7A 9976756 9977381 625 False 507.00 507 81.7750 1011 1623 1 chr7A.!!$F1 612
7 TraesCS7D01G081300 chrUn 49485309 49486869 1560 False 1923.00 1923 88.7930 570 2183 1 chrUn.!!$F3 1613
8 TraesCS7D01G081300 chrUn 49452720 49454258 1538 False 1773.00 1773 87.3460 570 2186 1 chrUn.!!$F1 1616
9 TraesCS7D01G081300 chr4A 663210375 663213185 2810 False 772.75 1214 92.1035 570 2593 4 chr4A.!!$F1 2023

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
127 128 0.759436 ACACCACACTCTTCCGAGGT 60.759 55.0 0.0 0.0 41.71 3.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2444 2861 6.885918 TGTATTCTCATGCAAAGAATCAAGGA 59.114 34.615 23.5 9.54 41.42 3.36 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
127 128 0.759436 ACACCACACTCTTCCGAGGT 60.759 55.0 0.0 0.0 41.71 3.85
2302 2719 0.531311 GGTGAGGTTCGTCCGTTGTT 60.531 55.0 0.0 0.0 41.99 2.83
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
422 423 1.290134 CAAACTCTCCCCCTAGCCTT 58.710 55.000 0.0 0.00 0.00 4.35
2444 2861 6.885918 TGTATTCTCATGCAAAGAATCAAGGA 59.114 34.615 23.5 9.54 41.42 3.36


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.