Multiple sequence alignment - TraesCS7D01G059200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G059200 chr7D 100.000 4791 0 0 1 4791 31962344 31957554 0.000000e+00 8848.0
1 TraesCS7D01G059200 chr7D 93.100 1000 41 4 1547 2545 32004505 32003533 0.000000e+00 1439.0
2 TraesCS7D01G059200 chr7D 86.785 507 27 8 989 1475 32005215 32004729 3.280000e-146 529.0
3 TraesCS7D01G059200 chr7D 85.681 426 50 6 1646 2071 31943093 31943507 5.690000e-119 438.0
4 TraesCS7D01G059200 chr7D 83.258 442 53 11 3545 3969 32002925 32002488 2.090000e-103 387.0
5 TraesCS7D01G059200 chr7D 90.708 226 19 2 2988 3211 31950224 31949999 2.800000e-77 300.0
6 TraesCS7D01G059200 chr7D 84.053 301 40 6 145 442 32005969 32005674 2.820000e-72 283.0
7 TraesCS7D01G059200 chr7A 90.999 4833 269 77 69 4791 32038719 32033943 0.000000e+00 6362.0
8 TraesCS7D01G059200 chr7A 95.083 3539 108 20 1 3501 32297091 32293581 0.000000e+00 5511.0
9 TraesCS7D01G059200 chr7A 98.485 1188 16 2 3501 4688 32293459 32292274 0.000000e+00 2093.0
10 TraesCS7D01G059200 chr7A 93.436 1234 60 9 260 1477 32063362 32062134 0.000000e+00 1810.0
11 TraesCS7D01G059200 chr7A 91.613 620 41 9 3489 4106 32197299 32196689 0.000000e+00 846.0
12 TraesCS7D01G059200 chr7A 87.032 694 52 18 1771 2441 32129255 32128577 0.000000e+00 749.0
13 TraesCS7D01G059200 chr7A 77.993 877 129 32 2988 3820 32027140 32026284 4.310000e-135 492.0
14 TraesCS7D01G059200 chr7A 82.495 537 46 24 4080 4585 32196370 32195851 1.230000e-115 427.0
15 TraesCS7D01G059200 chr7A 84.543 427 49 9 1646 2071 32009436 32009846 1.610000e-109 407.0
16 TraesCS7D01G059200 chr7A 90.708 226 19 2 2988 3211 32303058 32302833 2.800000e-77 300.0
17 TraesCS7D01G059200 chr7A 85.019 267 24 8 201 461 32158448 32158192 1.710000e-64 257.0
18 TraesCS7D01G059200 chr7A 99.074 108 1 0 4684 4791 32291846 32291739 1.360000e-45 195.0
19 TraesCS7D01G059200 chr7A 97.727 44 1 0 137 180 32063562 32063519 5.140000e-10 76.8
20 TraesCS7D01G059200 chrUn 89.899 2881 210 35 1547 4369 298011905 298009048 0.000000e+00 3633.0
21 TraesCS7D01G059200 chrUn 89.635 1563 115 14 1548 3083 238523499 238521957 0.000000e+00 1945.0
22 TraesCS7D01G059200 chrUn 89.635 1563 115 14 1548 3083 238537608 238536066 0.000000e+00 1945.0
23 TraesCS7D01G059200 chrUn 89.635 1563 115 14 1548 3083 271022380 271020838 0.000000e+00 1945.0
24 TraesCS7D01G059200 chrUn 89.635 1563 115 14 1548 3083 278812500 278814042 0.000000e+00 1945.0
25 TraesCS7D01G059200 chrUn 88.981 1570 119 16 1548 3084 176753955 176755503 0.000000e+00 1892.0
26 TraesCS7D01G059200 chrUn 84.877 972 106 15 534 1477 238524687 238523729 0.000000e+00 942.0
27 TraesCS7D01G059200 chrUn 84.877 972 106 15 534 1477 238538796 238537838 0.000000e+00 942.0
28 TraesCS7D01G059200 chrUn 84.877 972 106 15 534 1477 271023568 271022610 0.000000e+00 942.0
29 TraesCS7D01G059200 chrUn 84.877 972 106 15 534 1477 278811312 278812270 0.000000e+00 942.0
30 TraesCS7D01G059200 chrUn 84.227 970 115 14 534 1477 176718584 176719541 0.000000e+00 909.0
31 TraesCS7D01G059200 chrUn 89.919 496 29 13 1002 1477 298012538 298012044 1.890000e-173 619.0
32 TraesCS7D01G059200 chrUn 84.063 571 57 20 1503 2071 359477397 359477935 1.980000e-143 520.0
33 TraesCS7D01G059200 chr3B 89.618 1570 109 14 1548 3084 713873994 713872446 0.000000e+00 1947.0
34 TraesCS7D01G059200 chr3B 84.639 970 111 13 534 1477 713807089 713806132 0.000000e+00 931.0
35 TraesCS7D01G059200 chr3B 85.496 524 52 14 1548 2071 713805921 713805422 4.250000e-145 525.0
36 TraesCS7D01G059200 chr2D 81.362 1454 192 50 69 1477 91377694 91379113 0.000000e+00 1110.0
37 TraesCS7D01G059200 chr2D 77.494 862 120 46 87 917 91446597 91447415 2.630000e-122 449.0
38 TraesCS7D01G059200 chr2D 82.704 318 40 10 148 461 91461865 91462171 7.900000e-68 268.0
39 TraesCS7D01G059200 chr2D 86.957 138 12 5 292 426 91472606 91472740 2.990000e-32 150.0
40 TraesCS7D01G059200 chr4A 88.955 670 47 19 3306 3958 695993009 695993668 0.000000e+00 802.0
41 TraesCS7D01G059200 chr4A 78.182 880 123 37 2988 3820 696003992 696004849 9.260000e-137 497.0
42 TraesCS7D01G059200 chr4A 84.434 424 58 4 1648 2071 696010992 696010577 1.240000e-110 411.0
43 TraesCS7D01G059200 chr4A 82.659 173 19 9 4420 4585 695341298 695341466 5.000000e-30 143.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G059200 chr7D 31957554 31962344 4790 True 8848.000000 8848 100.000000 1 4791 1 chr7D.!!$R2 4790
1 TraesCS7D01G059200 chr7D 32002488 32005969 3481 True 659.500000 1439 86.799000 145 3969 4 chr7D.!!$R3 3824
2 TraesCS7D01G059200 chr7A 32033943 32038719 4776 True 6362.000000 6362 90.999000 69 4791 1 chr7A.!!$R2 4722
3 TraesCS7D01G059200 chr7A 32291739 32297091 5352 True 2599.666667 5511 97.547333 1 4791 3 chr7A.!!$R8 4790
4 TraesCS7D01G059200 chr7A 32062134 32063562 1428 True 943.400000 1810 95.581500 137 1477 2 chr7A.!!$R6 1340
5 TraesCS7D01G059200 chr7A 32128577 32129255 678 True 749.000000 749 87.032000 1771 2441 1 chr7A.!!$R3 670
6 TraesCS7D01G059200 chr7A 32195851 32197299 1448 True 636.500000 846 87.054000 3489 4585 2 chr7A.!!$R7 1096
7 TraesCS7D01G059200 chr7A 32026284 32027140 856 True 492.000000 492 77.993000 2988 3820 1 chr7A.!!$R1 832
8 TraesCS7D01G059200 chrUn 298009048 298012538 3490 True 2126.000000 3633 89.909000 1002 4369 2 chrUn.!!$R4 3367
9 TraesCS7D01G059200 chrUn 176753955 176755503 1548 False 1892.000000 1892 88.981000 1548 3084 1 chrUn.!!$F2 1536
10 TraesCS7D01G059200 chrUn 238521957 238524687 2730 True 1443.500000 1945 87.256000 534 3083 2 chrUn.!!$R1 2549
11 TraesCS7D01G059200 chrUn 238536066 238538796 2730 True 1443.500000 1945 87.256000 534 3083 2 chrUn.!!$R2 2549
12 TraesCS7D01G059200 chrUn 271020838 271023568 2730 True 1443.500000 1945 87.256000 534 3083 2 chrUn.!!$R3 2549
13 TraesCS7D01G059200 chrUn 278811312 278814042 2730 False 1443.500000 1945 87.256000 534 3083 2 chrUn.!!$F4 2549
14 TraesCS7D01G059200 chrUn 176718584 176719541 957 False 909.000000 909 84.227000 534 1477 1 chrUn.!!$F1 943
15 TraesCS7D01G059200 chrUn 359477397 359477935 538 False 520.000000 520 84.063000 1503 2071 1 chrUn.!!$F3 568
16 TraesCS7D01G059200 chr3B 713872446 713873994 1548 True 1947.000000 1947 89.618000 1548 3084 1 chr3B.!!$R1 1536
17 TraesCS7D01G059200 chr3B 713805422 713807089 1667 True 728.000000 931 85.067500 534 2071 2 chr3B.!!$R2 1537
18 TraesCS7D01G059200 chr2D 91377694 91379113 1419 False 1110.000000 1110 81.362000 69 1477 1 chr2D.!!$F1 1408
19 TraesCS7D01G059200 chr2D 91446597 91447415 818 False 449.000000 449 77.494000 87 917 1 chr2D.!!$F2 830
20 TraesCS7D01G059200 chr4A 695993009 695993668 659 False 802.000000 802 88.955000 3306 3958 1 chr4A.!!$F2 652
21 TraesCS7D01G059200 chr4A 696003992 696004849 857 False 497.000000 497 78.182000 2988 3820 1 chr4A.!!$F3 832

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
316 445 0.611200 ATGCCGTGTAGGTGTTGCTA 59.389 50.000 0.00 0.00 43.70 3.49 F
1121 1330 1.027792 GCCGGATCCTTTGCCGTTTA 61.028 55.000 5.05 0.00 45.85 2.01 F
1712 2109 2.869801 CTCAACCAAAGTGCTACGTGAA 59.130 45.455 0.00 0.00 0.00 3.18 F
2617 3040 3.119743 TGAACGATCGTTACCTTCGTGAT 60.120 43.478 31.79 6.94 44.62 3.06 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1121 1330 1.277557 GGGTGAACTCTCTGATGCAGT 59.722 52.381 0.00 0.00 32.61 4.40 R
1986 2383 1.864669 ACCCCAGTTATTTGCCATGG 58.135 50.000 7.63 7.63 0.00 3.66 R
3348 3818 1.815003 CTTTAGCAACAGAAGGCCAGG 59.185 52.381 5.01 0.00 0.00 4.45 R
4114 5092 3.203716 GGGACAATCCAGGTTCGAATAC 58.796 50.000 0.00 0.00 38.64 1.89 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
48 49 4.133078 GGAATTGGAGACATCAGGACATC 58.867 47.826 0.00 0.00 42.32 3.06
59 60 0.952497 CAGGACATCAGCAAGCACGT 60.952 55.000 0.00 0.00 0.00 4.49
316 445 0.611200 ATGCCGTGTAGGTGTTGCTA 59.389 50.000 0.00 0.00 43.70 3.49
1121 1330 1.027792 GCCGGATCCTTTGCCGTTTA 61.028 55.000 5.05 0.00 45.85 2.01
1404 1637 4.579869 CCAGTAATATGGTGGTAGATGGC 58.420 47.826 0.00 0.00 35.47 4.40
1477 1710 5.891551 AGGATGGTCAACAGTAAAAACTTGT 59.108 36.000 0.00 0.00 0.00 3.16
1495 1789 7.464830 AACTTGTGACTAATCATATACGTGC 57.535 36.000 0.00 0.00 37.14 5.34
1496 1790 6.806751 ACTTGTGACTAATCATATACGTGCT 58.193 36.000 0.00 0.00 37.14 4.40
1497 1791 7.937649 ACTTGTGACTAATCATATACGTGCTA 58.062 34.615 0.00 0.00 37.14 3.49
1498 1792 8.577296 ACTTGTGACTAATCATATACGTGCTAT 58.423 33.333 0.00 0.00 37.14 2.97
1500 1794 9.758651 TTGTGACTAATCATATACGTGCTATTT 57.241 29.630 0.00 0.00 37.14 1.40
1529 1909 7.672983 TTTAGAGAGTAAACTGAATGCTTGG 57.327 36.000 0.00 0.00 0.00 3.61
1530 1910 4.006319 AGAGAGTAAACTGAATGCTTGGC 58.994 43.478 0.00 0.00 0.00 4.52
1531 1911 3.753272 GAGAGTAAACTGAATGCTTGGCA 59.247 43.478 0.00 0.00 44.86 4.92
1533 1913 4.768968 AGAGTAAACTGAATGCTTGGCAAT 59.231 37.500 0.00 0.00 43.62 3.56
1534 1914 5.244626 AGAGTAAACTGAATGCTTGGCAATT 59.755 36.000 0.00 0.00 43.62 2.32
1536 1916 6.991938 AGTAAACTGAATGCTTGGCAATTTA 58.008 32.000 0.00 0.00 43.62 1.40
1537 1917 7.441017 AGTAAACTGAATGCTTGGCAATTTAA 58.559 30.769 0.00 0.00 43.62 1.52
1538 1918 8.096414 AGTAAACTGAATGCTTGGCAATTTAAT 58.904 29.630 0.00 0.00 43.62 1.40
1539 1919 7.748691 AAACTGAATGCTTGGCAATTTAATT 57.251 28.000 0.00 0.00 43.62 1.40
1541 1921 7.832503 ACTGAATGCTTGGCAATTTAATTAC 57.167 32.000 0.00 0.00 43.62 1.89
1545 1925 9.060347 TGAATGCTTGGCAATTTAATTACAAAA 57.940 25.926 0.00 2.35 43.62 2.44
1613 2010 4.497340 GCCTTCAACACAGAAATCGTGAAA 60.497 41.667 10.73 4.03 37.80 2.69
1640 2037 7.847711 TCTCTTTGGAAATGGGATTTTTGTA 57.152 32.000 0.00 0.00 31.47 2.41
1712 2109 2.869801 CTCAACCAAAGTGCTACGTGAA 59.130 45.455 0.00 0.00 0.00 3.18
1818 2215 5.126067 ACATGCAGGTACTTCCATGATTAC 58.874 41.667 15.25 0.00 38.65 1.89
1982 2379 7.913674 ACTGCCAAACAAAAATTCAGTTAAA 57.086 28.000 0.00 0.00 30.08 1.52
1986 2383 8.394121 TGCCAAACAAAAATTCAGTTAAACATC 58.606 29.630 0.00 0.00 0.00 3.06
2025 2422 6.126420 TGGGGTAAACCTAGTTTCTTCAGAAA 60.126 38.462 0.00 0.00 39.39 2.52
2367 2790 6.726490 AATATCGGGTCAGAAGCTAAACTA 57.274 37.500 0.00 0.00 0.00 2.24
2438 2861 8.021973 CCATCAAAAGAGAGAGAACATGAAAAG 58.978 37.037 0.00 0.00 0.00 2.27
2446 2869 8.535335 AGAGAGAGAACATGAAAAGCATAAGTA 58.465 33.333 0.00 0.00 34.82 2.24
2617 3040 3.119743 TGAACGATCGTTACCTTCGTGAT 60.120 43.478 31.79 6.94 44.62 3.06
2653 3076 3.327757 TCCTGATTGCTGGTAAAGACACT 59.672 43.478 0.00 0.00 34.91 3.55
4114 5092 1.489481 TCAGTGAGCATACCAGGAGG 58.511 55.000 0.00 0.00 42.21 4.30
4279 5282 4.532126 TCTCACCACTATTGTGTCTCCATT 59.468 41.667 6.55 0.00 42.34 3.16
4587 5608 8.995220 TCAATACTACACAATACCAACAAAGAC 58.005 33.333 0.00 0.00 0.00 3.01
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
48 49 2.979813 GTGGAATTAAACGTGCTTGCTG 59.020 45.455 0.00 0.00 0.00 4.41
186 191 4.080356 AGTTGACAGGGCTGCATAAGAATA 60.080 41.667 0.50 0.00 0.00 1.75
752 943 3.242739 GCGCTGATTGGTCGTTGAATATT 60.243 43.478 0.00 0.00 0.00 1.28
823 1023 2.143122 GGACAGTGTCGCAGAAAATGA 58.857 47.619 16.89 0.00 43.35 2.57
832 1032 0.307760 CAGGTTTTGGACAGTGTCGC 59.692 55.000 16.89 10.46 32.65 5.19
880 1086 8.200792 GGTTGATGTCACTGTCTTCTAGAATAT 58.799 37.037 5.44 0.00 0.00 1.28
1121 1330 1.277557 GGGTGAACTCTCTGATGCAGT 59.722 52.381 0.00 0.00 32.61 4.40
1331 1544 5.905913 AGGAGAACTACCCTGCTGTATTTAT 59.094 40.000 0.00 0.00 30.95 1.40
1450 1683 7.074653 AGTTTTTACTGTTGACCATCCTCTA 57.925 36.000 0.00 0.00 0.00 2.43
1526 1906 9.823647 TCAGACTTTTTGTAATTAAATTGCCAA 57.176 25.926 0.00 0.00 0.00 4.52
1538 1918 9.997482 GTCAAATTGTAGTCAGACTTTTTGTAA 57.003 29.630 8.80 0.00 0.00 2.41
1539 1919 9.168451 TGTCAAATTGTAGTCAGACTTTTTGTA 57.832 29.630 8.80 6.16 0.00 2.41
1541 1921 8.909708 TTGTCAAATTGTAGTCAGACTTTTTG 57.090 30.769 8.80 13.20 0.00 2.44
1545 1925 8.509690 CATCATTGTCAAATTGTAGTCAGACTT 58.490 33.333 8.80 0.00 0.00 3.01
1613 2010 7.236225 ACAAAAATCCCATTTCCAAAGAGATCT 59.764 33.333 0.00 0.00 0.00 2.75
1640 2037 1.450211 CCACTTGTCCCCGTCTGTT 59.550 57.895 0.00 0.00 0.00 3.16
1982 2379 3.033184 CCCAGTTATTTGCCATGGATGT 58.967 45.455 18.40 0.00 32.55 3.06
1986 2383 1.864669 ACCCCAGTTATTTGCCATGG 58.135 50.000 7.63 7.63 0.00 3.66
2438 2861 7.698130 CAGTTTTTCTTACATGGCTACTTATGC 59.302 37.037 0.00 0.00 0.00 3.14
2446 2869 4.454504 CCGTACAGTTTTTCTTACATGGCT 59.545 41.667 0.00 0.00 0.00 4.75
2782 3205 2.694628 AGCACCTTGTTTCAATCTTGCA 59.305 40.909 0.00 0.00 0.00 4.08
3348 3818 1.815003 CTTTAGCAACAGAAGGCCAGG 59.185 52.381 5.01 0.00 0.00 4.45
3917 4548 8.850454 TTACTCTGTTTCATGCAAAGTTAAAC 57.150 30.769 0.00 0.00 0.00 2.01
4114 5092 3.203716 GGGACAATCCAGGTTCGAATAC 58.796 50.000 0.00 0.00 38.64 1.89
4279 5282 8.539544 TGTGATGAGATAAGAGTTGTGGAATTA 58.460 33.333 0.00 0.00 0.00 1.40
4587 5608 3.634397 TTTTACAGAGGGAGGCTGATG 57.366 47.619 0.00 0.00 36.86 3.07


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.