Multiple sequence alignment - TraesCS7D01G056100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G056100 chr7D 100.000 2617 0 0 1 2617 29884546 29881930 0.000000e+00 4833
1 TraesCS7D01G056100 chr7D 77.268 1069 181 28 921 1937 27485452 27486510 2.920000e-159 571
2 TraesCS7D01G056100 chr1D 97.799 2635 33 6 1 2617 115569328 115566701 0.000000e+00 4521
3 TraesCS7D01G056100 chr1D 81.651 218 32 4 988 1204 468745819 468746029 9.630000e-40 174
4 TraesCS7D01G056100 chr6D 97.995 1995 29 5 1 1985 454644201 454642208 0.000000e+00 3452
5 TraesCS7D01G056100 chr6D 96.834 537 7 1 2091 2617 454642214 454641678 0.000000e+00 889
6 TraesCS7D01G056100 chr1A 89.351 385 34 4 826 1204 16477972 16477589 6.550000e-131 477
7 TraesCS7D01G056100 chr1A 82.110 218 31 4 988 1204 561587018 561587228 2.070000e-41 180
8 TraesCS7D01G056100 chr1A 87.075 147 11 6 1 144 6071810 6071669 2.700000e-35 159
9 TraesCS7D01G056100 chr1A 91.489 94 6 2 10 103 16478074 16477983 7.600000e-26 128
10 TraesCS7D01G056100 chr6B 86.667 180 16 7 1 175 712293837 712294013 2.660000e-45 193
11 TraesCS7D01G056100 chr7A 87.075 147 10 7 1 144 84693518 84693658 9.700000e-35 158
12 TraesCS7D01G056100 chr3A 87.075 147 10 7 1 144 93565943 93566083 9.700000e-35 158
13 TraesCS7D01G056100 chr4A 86.577 149 11 6 1 144 636121806 636121662 3.490000e-34 156
14 TraesCS7D01G056100 chr5B 86.395 147 13 5 1 144 315244533 315244391 1.250000e-33 154
15 TraesCS7D01G056100 chr3D 83.226 155 11 5 168 308 528126667 528126514 7.600000e-26 128
16 TraesCS7D01G056100 chr3D 83.007 153 11 5 170 308 553219851 553219700 9.830000e-25 124


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G056100 chr7D 29881930 29884546 2616 True 4833.0 4833 100.0000 1 2617 1 chr7D.!!$R1 2616
1 TraesCS7D01G056100 chr7D 27485452 27486510 1058 False 571.0 571 77.2680 921 1937 1 chr7D.!!$F1 1016
2 TraesCS7D01G056100 chr1D 115566701 115569328 2627 True 4521.0 4521 97.7990 1 2617 1 chr1D.!!$R1 2616
3 TraesCS7D01G056100 chr6D 454641678 454644201 2523 True 2170.5 3452 97.4145 1 2617 2 chr6D.!!$R1 2616

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
633 643 1.001764 CTTCCATCCACTGCTGGCA 60.002 57.895 0.0 0.0 37.49 4.92 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2570 2639 1.345415 GTTAACGGACACCCTTCCAGA 59.655 52.381 0.0 0.0 35.04 3.86 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
523 533 1.823470 GCAGTGCACCACCAGACAA 60.823 57.895 14.63 0.00 34.49 3.18
633 643 1.001764 CTTCCATCCACTGCTGGCA 60.002 57.895 0.00 0.00 37.49 4.92
848 859 2.092968 TGTCTCCACTGCATATGAACCC 60.093 50.000 6.97 0.00 0.00 4.11
882 893 4.527427 TGTTTGGATTGAATGCAGGATGAA 59.473 37.500 0.00 0.00 39.69 2.57
907 918 6.925165 ACTTTGTAAGGAAGACGACGAAATAA 59.075 34.615 0.00 0.00 0.00 1.40
1219 1239 4.579869 GACTGGATGGTCATTTGTGTACT 58.420 43.478 0.00 0.00 36.35 2.73
1902 1959 2.926200 CCAGAATTGAGTAGCTGTGTCG 59.074 50.000 0.00 0.00 0.00 4.35
2010 2069 1.115467 AAGGCGTACTAGAGCAGCAT 58.885 50.000 0.00 0.00 34.54 3.79
2481 2550 3.709880 TAGAACGGACATGGCGGCG 62.710 63.158 5.94 0.51 0.00 6.46
2570 2639 5.268387 TGCTGGGTTTACAATAATGATGGT 58.732 37.500 0.00 0.00 0.00 3.55
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
633 643 2.284625 TCCTGTCCGGATGCCACT 60.285 61.111 7.81 0.00 36.69 4.00
848 859 2.169832 ATCCAAACACACCAGACTCG 57.830 50.000 0.00 0.00 0.00 4.18
882 893 3.996150 TCGTCGTCTTCCTTACAAAGT 57.004 42.857 0.00 0.00 0.00 2.66
973 985 7.160633 ACTGAAAATCGGTTTGAAAAATTCG 57.839 32.000 0.00 0.00 30.35 3.34
1128 1148 1.248785 TACGCTGGAACTTCCTCGCT 61.249 55.000 17.37 10.57 37.46 4.93
1219 1239 1.019805 TCGTGTTGTGCAACCAACGA 61.020 50.000 19.50 19.50 46.08 3.85
1620 1658 6.618811 ACGTAGAGTGAACGAATACTTCATT 58.381 36.000 2.27 0.00 42.90 2.57
2051 2110 7.399245 AACTACAGGCTGAAAACACTAAAAA 57.601 32.000 23.66 0.00 0.00 1.94
2087 2146 5.450818 AAACCTGTCCCAGATTTGCTATA 57.549 39.130 0.00 0.00 32.44 1.31
2088 2147 4.322057 AAACCTGTCCCAGATTTGCTAT 57.678 40.909 0.00 0.00 32.44 2.97
2089 2148 3.806949 AAACCTGTCCCAGATTTGCTA 57.193 42.857 0.00 0.00 32.44 3.49
2090 2149 2.683211 AAACCTGTCCCAGATTTGCT 57.317 45.000 0.00 0.00 32.44 3.91
2299 2358 4.310769 CAGAAGTTCTGTCCGTCTTGAAT 58.689 43.478 22.48 0.00 39.58 2.57
2481 2550 2.158740 GCTCCATTCCCTTTCTAGTCCC 60.159 54.545 0.00 0.00 0.00 4.46
2570 2639 1.345415 GTTAACGGACACCCTTCCAGA 59.655 52.381 0.00 0.00 35.04 3.86


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.