Multiple sequence alignment - TraesCS7D01G055100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G055100 chr7D 100.000 2618 0 0 1 2618 29571719 29569102 0 4835
1 TraesCS7D01G055100 chr2D 98.321 2621 40 3 1 2618 644817768 644820387 0 4593
2 TraesCS7D01G055100 chr4D 97.979 2622 49 3 1 2618 403008998 403011619 0 4545
3 TraesCS7D01G055100 chr5A 97.865 2623 51 3 1 2618 139476837 139474215 0 4529
4 TraesCS7D01G055100 chr1D 97.633 2619 60 2 1 2618 187808474 187811091 0 4492
5 TraesCS7D01G055100 chr4B 95.368 2634 102 7 1 2618 74348787 74351416 0 4170
6 TraesCS7D01G055100 chr2B 95.144 2286 100 6 344 2618 63131876 63129591 0 3596
7 TraesCS7D01G055100 chr3D 95.584 2038 82 6 584 2618 107214418 107216450 0 3258
8 TraesCS7D01G055100 chr3D 96.121 593 16 5 1 588 107205662 107206252 0 961
9 TraesCS7D01G055100 chr6D 92.427 1809 89 15 1 1780 433250902 433252691 0 2538
10 TraesCS7D01G055100 chr6A 97.875 1365 23 3 1 1360 615073843 615072480 0 2355
11 TraesCS7D01G055100 chr6A 97.974 987 19 1 1632 2618 615072488 615071503 0 1711
12 TraesCS7D01G055100 chr2A 92.636 1616 84 12 183 1780 605004802 605003204 0 2292
13 TraesCS7D01G055100 chr7B 95.704 1257 52 2 1363 2618 400417620 400416365 0 2021
14 TraesCS7D01G055100 chr6B 95.841 529 18 3 1 526 128934558 128934031 0 852


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G055100 chr7D 29569102 29571719 2617 True 4835 4835 100.0000 1 2618 1 chr7D.!!$R1 2617
1 TraesCS7D01G055100 chr2D 644817768 644820387 2619 False 4593 4593 98.3210 1 2618 1 chr2D.!!$F1 2617
2 TraesCS7D01G055100 chr4D 403008998 403011619 2621 False 4545 4545 97.9790 1 2618 1 chr4D.!!$F1 2617
3 TraesCS7D01G055100 chr5A 139474215 139476837 2622 True 4529 4529 97.8650 1 2618 1 chr5A.!!$R1 2617
4 TraesCS7D01G055100 chr1D 187808474 187811091 2617 False 4492 4492 97.6330 1 2618 1 chr1D.!!$F1 2617
5 TraesCS7D01G055100 chr4B 74348787 74351416 2629 False 4170 4170 95.3680 1 2618 1 chr4B.!!$F1 2617
6 TraesCS7D01G055100 chr2B 63129591 63131876 2285 True 3596 3596 95.1440 344 2618 1 chr2B.!!$R1 2274
7 TraesCS7D01G055100 chr3D 107214418 107216450 2032 False 3258 3258 95.5840 584 2618 1 chr3D.!!$F2 2034
8 TraesCS7D01G055100 chr3D 107205662 107206252 590 False 961 961 96.1210 1 588 1 chr3D.!!$F1 587
9 TraesCS7D01G055100 chr6D 433250902 433252691 1789 False 2538 2538 92.4270 1 1780 1 chr6D.!!$F1 1779
10 TraesCS7D01G055100 chr6A 615071503 615073843 2340 True 2033 2355 97.9245 1 2618 2 chr6A.!!$R1 2617
11 TraesCS7D01G055100 chr2A 605003204 605004802 1598 True 2292 2292 92.6360 183 1780 1 chr2A.!!$R1 1597
12 TraesCS7D01G055100 chr7B 400416365 400417620 1255 True 2021 2021 95.7040 1363 2618 1 chr7B.!!$R1 1255
13 TraesCS7D01G055100 chr6B 128934031 128934558 527 True 852 852 95.8410 1 526 1 chr6B.!!$R1 525

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
910 948 2.839098 CCATTGCTAGGGGGCGAT 59.161 61.111 0.0 0.0 36.83 4.58 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1852 1922 1.000607 GGCGGGTTTTCCTCTGTTTTC 60.001 52.381 0.0 0.0 40.46 2.29 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
221 229 4.997395 AGTGACATTTATTCAGCGTGTTCT 59.003 37.500 0.00 0.00 0.00 3.01
225 233 6.649141 TGACATTTATTCAGCGTGTTCTAACT 59.351 34.615 0.00 0.00 0.00 2.24
649 686 8.664798 TGATGAAAGAAGAACATATTTGTACCG 58.335 33.333 0.00 0.00 34.06 4.02
910 948 2.839098 CCATTGCTAGGGGGCGAT 59.161 61.111 0.00 0.00 36.83 4.58
1005 1043 1.277273 CTCTTGAGAGACCACATGGCA 59.723 52.381 1.72 0.00 44.74 4.92
1048 1086 0.673985 GGTTGGAAGCCAAGAACACC 59.326 55.000 0.00 0.00 44.82 4.16
1206 1248 5.005779 CGACAGCTATTCAGAATAACCACAC 59.994 44.000 4.38 0.00 0.00 3.82
1221 1263 2.159310 ACCACACCAAAATTGTGACACG 60.159 45.455 0.00 0.00 46.18 4.49
1246 1288 2.643304 GGTTAGTGGGAGAAGGAACCTT 59.357 50.000 5.74 5.74 39.23 3.50
1333 1379 4.589908 AGTCACTCTGGAAAAAGTGTGTT 58.410 39.130 2.77 0.00 42.76 3.32
1601 1663 2.765689 ACTGGGTTCCATTTCCAACA 57.234 45.000 0.00 0.00 30.82 3.33
1884 1954 1.636148 AACCCGCCAGTCTTACTACA 58.364 50.000 0.00 0.00 0.00 2.74
2021 2091 6.209192 TCCAGTTTAACGAGTACTTGTGGATA 59.791 38.462 16.68 2.94 0.00 2.59
2532 2602 7.014038 AGGATGCATGTCAGATTTAAATTCTCC 59.986 37.037 2.46 0.00 0.00 3.71
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
195 203 5.451908 ACACGCTGAATAAATGTCACTTTG 58.548 37.500 0.00 0.00 0.00 2.77
578 615 7.386848 TGACAATACTTTTAAGCCACTGACTAC 59.613 37.037 0.00 0.00 0.00 2.73
649 686 3.057734 GTGTATAGTCAGCCGGCAATAC 58.942 50.000 31.54 24.11 0.00 1.89
910 948 0.107703 GATGGGTGGCGTTGATCTCA 60.108 55.000 0.00 0.00 0.00 3.27
1005 1043 1.070601 GCCAAAAACTGCCACCAGAAT 59.929 47.619 0.00 0.00 41.77 2.40
1048 1086 7.095229 TGTCAAGTCCGTGATCAAAATTAAGAG 60.095 37.037 0.00 0.00 0.00 2.85
1206 1248 1.269517 CCACCCGTGTCACAATTTTGG 60.270 52.381 3.42 0.00 0.00 3.28
1221 1263 0.618981 CCTTCTCCCACTAACCACCC 59.381 60.000 0.00 0.00 0.00 4.61
1246 1288 3.886044 CAGAATCGGCTGCGGTATA 57.114 52.632 7.10 0.00 0.00 1.47
1601 1663 9.388506 CACATACCATTCATAAGTTCTTCTCTT 57.611 33.333 0.00 0.00 0.00 2.85
1852 1922 1.000607 GGCGGGTTTTCCTCTGTTTTC 60.001 52.381 0.00 0.00 40.46 2.29
1884 1954 7.293073 ACCCATATTCTTGTTTGATGCTATCT 58.707 34.615 0.00 0.00 0.00 1.98
2021 2091 3.718723 AGAGTGCTCCTCCATCTAAACT 58.281 45.455 0.00 0.00 41.47 2.66
2492 2562 6.917533 ACATGCATCCTAACAAGAGAAAAAG 58.082 36.000 0.00 0.00 0.00 2.27
2581 2651 3.027170 GCACCTTCATGCGTGGACG 62.027 63.158 5.98 0.00 43.27 4.79


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.