Multiple sequence alignment - TraesCS7D01G053400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G053400 chr7D 100.000 3701 0 0 1 3701 28035657 28039357 0.000000e+00 6835
1 TraesCS7D01G053400 chr7D 74.223 2157 475 68 534 2653 18694003 18691891 0.000000e+00 828
2 TraesCS7D01G053400 chr7A 98.112 3708 61 3 1 3701 28454477 28458182 0.000000e+00 6451
3 TraesCS7D01G053400 chr4A 96.271 3352 107 9 1 3346 701757771 701761110 0.000000e+00 5481
4 TraesCS7D01G053400 chr4A 90.000 290 21 4 3418 3701 701761118 701761405 5.840000e-98 368
5 TraesCS7D01G053400 chr5D 75.734 1805 391 37 450 2235 555637008 555638784 0.000000e+00 863
6 TraesCS7D01G053400 chr5D 74.806 1802 406 40 453 2235 555556688 555558460 0.000000e+00 769
7 TraesCS7D01G053400 chr5B 74.958 1793 404 36 460 2234 695813222 695811457 0.000000e+00 782
8 TraesCS7D01G053400 chr5B 74.820 1803 407 38 453 2235 695695609 695693834 0.000000e+00 771
9 TraesCS7D01G053400 chr1B 74.777 1796 407 37 462 2237 433643636 433641867 0.000000e+00 765
10 TraesCS7D01G053400 chr3D 78.463 989 190 18 1669 2653 4958018 4957049 3.140000e-175 625
11 TraesCS7D01G053400 chr3D 82.601 569 97 2 1669 2236 9634699 9635266 5.520000e-138 501
12 TraesCS7D01G053400 chr3B 78.186 981 193 15 1669 2646 13816455 13817417 1.140000e-169 606
13 TraesCS7D01G053400 chrUn 78.746 861 162 15 1669 2526 284401434 284400592 1.160000e-154 556
14 TraesCS7D01G053400 chrUn 78.746 861 162 15 1669 2526 284407968 284407126 1.160000e-154 556
15 TraesCS7D01G053400 chrUn 78.746 861 162 15 1669 2526 302991593 302990751 1.160000e-154 556
16 TraesCS7D01G053400 chrUn 78.630 861 163 15 1669 2526 257885879 257885037 5.400000e-153 551


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G053400 chr7D 28035657 28039357 3700 False 6835.0 6835 100.0000 1 3701 1 chr7D.!!$F1 3700
1 TraesCS7D01G053400 chr7D 18691891 18694003 2112 True 828.0 828 74.2230 534 2653 1 chr7D.!!$R1 2119
2 TraesCS7D01G053400 chr7A 28454477 28458182 3705 False 6451.0 6451 98.1120 1 3701 1 chr7A.!!$F1 3700
3 TraesCS7D01G053400 chr4A 701757771 701761405 3634 False 2924.5 5481 93.1355 1 3701 2 chr4A.!!$F1 3700
4 TraesCS7D01G053400 chr5D 555637008 555638784 1776 False 863.0 863 75.7340 450 2235 1 chr5D.!!$F2 1785
5 TraesCS7D01G053400 chr5D 555556688 555558460 1772 False 769.0 769 74.8060 453 2235 1 chr5D.!!$F1 1782
6 TraesCS7D01G053400 chr5B 695811457 695813222 1765 True 782.0 782 74.9580 460 2234 1 chr5B.!!$R2 1774
7 TraesCS7D01G053400 chr5B 695693834 695695609 1775 True 771.0 771 74.8200 453 2235 1 chr5B.!!$R1 1782
8 TraesCS7D01G053400 chr1B 433641867 433643636 1769 True 765.0 765 74.7770 462 2237 1 chr1B.!!$R1 1775
9 TraesCS7D01G053400 chr3D 4957049 4958018 969 True 625.0 625 78.4630 1669 2653 1 chr3D.!!$R1 984
10 TraesCS7D01G053400 chr3D 9634699 9635266 567 False 501.0 501 82.6010 1669 2236 1 chr3D.!!$F1 567
11 TraesCS7D01G053400 chr3B 13816455 13817417 962 False 606.0 606 78.1860 1669 2646 1 chr3B.!!$F1 977
12 TraesCS7D01G053400 chrUn 284400592 284401434 842 True 556.0 556 78.7460 1669 2526 1 chrUn.!!$R2 857
13 TraesCS7D01G053400 chrUn 284407126 284407968 842 True 556.0 556 78.7460 1669 2526 1 chrUn.!!$R3 857
14 TraesCS7D01G053400 chrUn 302990751 302991593 842 True 556.0 556 78.7460 1669 2526 1 chrUn.!!$R4 857
15 TraesCS7D01G053400 chrUn 257885037 257885879 842 True 551.0 551 78.6300 1669 2526 1 chrUn.!!$R1 857

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
854 859 5.363868 TCCCAGAGTCCATTACTACAATGAG 59.636 44.000 0.0 0.0 39.07 2.9 F
1666 1682 5.769367 CCGATCCGACTGATTCTGTAATAA 58.231 41.667 0.0 0.0 32.41 1.4 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1976 1993 0.105039 GTATGTCGAGCCTTGAGGGG 59.895 60.000 0.0 0.00 35.18 4.79 R
3416 3467 2.945008 AGCTACGTGCATGCATGTTATT 59.055 40.909 41.5 26.64 42.86 1.40 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
854 859 5.363868 TCCCAGAGTCCATTACTACAATGAG 59.636 44.000 0.00 0.0 39.07 2.90
1666 1682 5.769367 CCGATCCGACTGATTCTGTAATAA 58.231 41.667 0.00 0.0 32.41 1.40
1989 2009 0.970937 TACACTCCCCTCAAGGCTCG 60.971 60.000 0.00 0.0 0.00 5.03
2011 2031 2.290960 ACATACTTGGGGTTCCTTGAGC 60.291 50.000 0.00 0.0 0.00 4.26
2121 2141 2.143122 AGCAACGTGTTGTTCGATGAT 58.857 42.857 13.73 0.0 42.31 2.45
2943 2991 1.630244 CTGCGAGGTGTTGTAGCAGC 61.630 60.000 2.77 0.0 46.69 5.25
3293 3344 3.018856 GACATTGGTCATCAGCCATCAA 58.981 45.455 0.00 0.0 43.73 2.57
3405 3456 4.391830 GCACGAATCCTAATCTCAACACAA 59.608 41.667 0.00 0.0 0.00 3.33
3416 3467 9.667107 CCTAATCTCAACACAAATCCTAAGTTA 57.333 33.333 0.00 0.0 0.00 2.24
3431 3482 7.026631 TCCTAAGTTAATAACATGCATGCAC 57.973 36.000 25.37 12.9 0.00 4.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
854 859 5.249420 AGAGGTTAAGAAGCACCAGATTTC 58.751 41.667 0.00 0.00 35.25 2.17
958 963 6.905736 TGGTTGGTATAGAGCCAATGAATTA 58.094 36.000 0.00 0.00 46.25 1.40
1976 1993 0.105039 GTATGTCGAGCCTTGAGGGG 59.895 60.000 0.00 0.00 35.18 4.79
1989 2009 3.610911 CTCAAGGAACCCCAAGTATGTC 58.389 50.000 0.00 0.00 33.88 3.06
2011 2031 0.533531 TCAAGCATGATGCCTAGCCG 60.534 55.000 14.72 0.00 46.52 5.52
2301 2329 7.010460 GGAATTCATGAAAGGAAATTTAAGGCG 59.990 37.037 13.09 0.00 41.37 5.52
2943 2991 6.128526 GGACTTCATTTTTACTGACCTTCTCG 60.129 42.308 0.00 0.00 0.00 4.04
3382 3433 3.932710 TGTGTTGAGATTAGGATTCGTGC 59.067 43.478 0.00 0.00 0.00 5.34
3405 3456 8.137437 GTGCATGCATGTTATTAACTTAGGATT 58.863 33.333 25.64 0.00 0.00 3.01
3416 3467 2.945008 AGCTACGTGCATGCATGTTATT 59.055 40.909 41.50 26.64 42.86 1.40
3668 3725 3.257873 TCGGCCAATTGAAAATGTCATGT 59.742 39.130 7.12 0.00 35.70 3.21


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.