Multiple sequence alignment - TraesCS7D01G045600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G045600 chr7D 100.000 1280 0 0 919 2198 22969045 22967766 0.000000e+00 2364.0
1 TraesCS7D01G045600 chr7D 98.594 1280 18 0 919 2198 22949531 22950810 0.000000e+00 2265.0
2 TraesCS7D01G045600 chr7D 91.171 1144 101 0 919 2062 617635457 617636600 0.000000e+00 1554.0
3 TraesCS7D01G045600 chr7D 91.236 1141 97 3 919 2058 90837498 90836360 0.000000e+00 1550.0
4 TraesCS7D01G045600 chr7D 100.000 627 0 0 1 627 22969963 22969337 0.000000e+00 1158.0
5 TraesCS7D01G045600 chr7D 99.203 627 5 0 1 627 22948846 22949472 0.000000e+00 1131.0
6 TraesCS7D01G045600 chr3A 92.287 1141 86 2 920 2060 444719683 444720821 0.000000e+00 1618.0
7 TraesCS7D01G045600 chr1D 92.126 1143 85 4 919 2059 377914436 377915575 0.000000e+00 1607.0
8 TraesCS7D01G045600 chr1D 92.028 1129 85 5 929 2057 238648340 238647217 0.000000e+00 1581.0
9 TraesCS7D01G045600 chr2D 92.004 1138 85 6 929 2066 645447151 645448282 0.000000e+00 1592.0
10 TraesCS7D01G045600 chr3D 92.028 1129 84 6 929 2057 588018933 588017811 0.000000e+00 1581.0
11 TraesCS7D01G045600 chr6D 91.381 1137 96 2 922 2057 465752136 465751001 0.000000e+00 1555.0
12 TraesCS7D01G045600 chr6D 100.000 31 0 0 387 417 159781130 159781100 8.480000e-05 58.4
13 TraesCS7D01G045600 chr4A 96.975 628 18 1 1 627 706833624 706832997 0.000000e+00 1053.0
14 TraesCS7D01G045600 chr4D 86.224 196 16 4 269 459 477091179 477090990 3.700000e-48 202.0
15 TraesCS7D01G045600 chr4D 93.443 61 4 0 441 501 477090980 477090920 8.360000e-15 91.6
16 TraesCS7D01G045600 chr7A 85.427 199 18 4 263 456 31004201 31004393 1.720000e-46 196.0
17 TraesCS7D01G045600 chr7A 90.361 83 8 0 416 498 671726165 671726247 2.310000e-20 110.0
18 TraesCS7D01G045600 chr3B 86.010 193 15 5 269 456 780550190 780550005 1.720000e-46 196.0
19 TraesCS7D01G045600 chr3B 84.925 199 18 5 263 456 55721495 55721686 8.010000e-45 191.0
20 TraesCS7D01G045600 chr4B 92.537 67 5 0 433 499 182648891 182648957 1.800000e-16 97.1
21 TraesCS7D01G045600 chr6A 100.000 29 0 0 387 415 218906063 218906091 1.000000e-03 54.7


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G045600 chr7D 22967766 22969963 2197 True 1761 2364 100.0000 1 2198 2 chr7D.!!$R2 2197
1 TraesCS7D01G045600 chr7D 22948846 22950810 1964 False 1698 2265 98.8985 1 2198 2 chr7D.!!$F2 2197
2 TraesCS7D01G045600 chr7D 617635457 617636600 1143 False 1554 1554 91.1710 919 2062 1 chr7D.!!$F1 1143
3 TraesCS7D01G045600 chr7D 90836360 90837498 1138 True 1550 1550 91.2360 919 2058 1 chr7D.!!$R1 1139
4 TraesCS7D01G045600 chr3A 444719683 444720821 1138 False 1618 1618 92.2870 920 2060 1 chr3A.!!$F1 1140
5 TraesCS7D01G045600 chr1D 377914436 377915575 1139 False 1607 1607 92.1260 919 2059 1 chr1D.!!$F1 1140
6 TraesCS7D01G045600 chr1D 238647217 238648340 1123 True 1581 1581 92.0280 929 2057 1 chr1D.!!$R1 1128
7 TraesCS7D01G045600 chr2D 645447151 645448282 1131 False 1592 1592 92.0040 929 2066 1 chr2D.!!$F1 1137
8 TraesCS7D01G045600 chr3D 588017811 588018933 1122 True 1581 1581 92.0280 929 2057 1 chr3D.!!$R1 1128
9 TraesCS7D01G045600 chr6D 465751001 465752136 1135 True 1555 1555 91.3810 922 2057 1 chr6D.!!$R2 1135
10 TraesCS7D01G045600 chr4A 706832997 706833624 627 True 1053 1053 96.9750 1 627 1 chr4A.!!$R1 626

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
148 150 2.435059 GGCGGCACACCTCTTCTC 60.435 66.667 3.07 0.0 0.0 2.87 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1935 1940 0.25064 ATGCCTGAATCCGCCATCTC 60.251 55.0 0.0 0.0 0.0 2.75 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
148 150 2.435059 GGCGGCACACCTCTTCTC 60.435 66.667 3.07 0.0 0.00 2.87
267 269 3.980646 TCTTCCGAACCAACATTTGTG 57.019 42.857 0.00 0.0 0.00 3.33
591 593 3.125316 CCTGCTAAAAACCTGATGTCGTC 59.875 47.826 0.00 0.0 0.00 4.20
1044 1046 1.496429 CCCTACTTCTGCATGGGGAAT 59.504 52.381 0.15 0.0 36.17 3.01
2187 2192 0.824595 TGCCTTGCTTGCTCATGTGT 60.825 50.000 0.00 0.0 0.00 3.72
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
148 150 2.170166 TGCTTTTATGCACCCCAGAAG 58.830 47.619 0.00 0.0 38.12 2.85
463 465 5.166553 AACACCTAGTTTCACACCAAGTGG 61.167 45.833 0.00 0.0 40.10 4.00
591 593 7.943735 GCACGTGCTATAATATGAATTGATG 57.056 36.000 32.55 0.0 38.21 3.07
925 927 4.741239 GAGGTGGAGAGGGGGCCA 62.741 72.222 4.39 0.0 0.00 5.36
1044 1046 4.458829 ACCGCTCCAGATCCGGGA 62.459 66.667 0.00 0.0 45.93 5.14
1657 1662 2.202756 CCACCTACGCGAGCCTTC 60.203 66.667 15.93 0.0 0.00 3.46
1888 1893 2.726821 GAATGATGAAGGGGTGCAAGA 58.273 47.619 0.00 0.0 0.00 3.02
1935 1940 0.250640 ATGCCTGAATCCGCCATCTC 60.251 55.000 0.00 0.0 0.00 2.75


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.