Multiple sequence alignment - TraesCS7D01G034900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G034900 chr7D 100.000 2375 0 0 1 2375 17927658 17925284 0.000000e+00 4386.0
1 TraesCS7D01G034900 chr7D 99.241 527 4 0 1 527 106585042 106584516 0.000000e+00 952.0
2 TraesCS7D01G034900 chr7D 99.241 527 3 1 1 527 1712736 1712211 0.000000e+00 950.0
3 TraesCS7D01G034900 chr7D 99.057 530 3 2 1 528 18905525 18904996 0.000000e+00 950.0
4 TraesCS7D01G034900 chr2D 95.579 1832 57 6 522 2329 645236160 645234329 0.000000e+00 2913.0
5 TraesCS7D01G034900 chr3A 94.792 1824 62 12 522 2331 615136216 615134412 0.000000e+00 2811.0
6 TraesCS7D01G034900 chr3A 91.673 1417 82 18 928 2329 702241641 702243036 0.000000e+00 1930.0
7 TraesCS7D01G034900 chr4D 93.564 1849 67 17 522 2329 236672154 236670317 0.000000e+00 2708.0
8 TraesCS7D01G034900 chr4D 96.296 54 0 2 2322 2375 9173359 9173410 1.170000e-13 87.9
9 TraesCS7D01G034900 chr4D 100.000 47 0 0 2329 2375 286642839 286642793 1.170000e-13 87.9
10 TraesCS7D01G034900 chr4D 96.296 54 0 2 2322 2375 289594679 289594730 1.170000e-13 87.9
11 TraesCS7D01G034900 chr4D 100.000 47 0 0 2329 2375 307531843 307531797 1.170000e-13 87.9
12 TraesCS7D01G034900 chr4D 96.296 54 0 2 2322 2375 348179077 348179128 1.170000e-13 87.9
13 TraesCS7D01G034900 chr4D 100.000 47 0 0 2329 2375 364890558 364890512 1.170000e-13 87.9
14 TraesCS7D01G034900 chr4D 100.000 47 0 0 2329 2375 404289485 404289439 1.170000e-13 87.9
15 TraesCS7D01G034900 chr4D 96.296 54 0 2 2322 2375 414313564 414313615 1.170000e-13 87.9
16 TraesCS7D01G034900 chr4D 100.000 47 0 0 2329 2375 414391351 414391305 1.170000e-13 87.9
17 TraesCS7D01G034900 chr1D 93.330 1844 70 15 522 2330 463793140 463791315 0.000000e+00 2675.0
18 TraesCS7D01G034900 chr1D 99.426 523 3 0 1 523 1732274 1731752 0.000000e+00 950.0
19 TraesCS7D01G034900 chr1D 99.426 523 3 0 1 523 10485291 10485813 0.000000e+00 950.0
20 TraesCS7D01G034900 chr1D 99.426 523 3 0 1 523 11944268 11943746 0.000000e+00 950.0
21 TraesCS7D01G034900 chr2A 91.816 1845 75 22 522 2329 610789745 610791550 0.000000e+00 2501.0
22 TraesCS7D01G034900 chr7A 91.307 1852 86 24 522 2329 56074402 56076222 0.000000e+00 2459.0
23 TraesCS7D01G034900 chr5A 91.267 1855 80 28 522 2329 235675598 235677417 0.000000e+00 2453.0
24 TraesCS7D01G034900 chr5A 84.795 171 13 6 2172 2330 75977540 75977371 2.440000e-35 159.0
25 TraesCS7D01G034900 chr5D 92.683 1435 64 25 928 2332 384511157 384509734 0.000000e+00 2030.0
26 TraesCS7D01G034900 chr5D 92.372 1442 63 21 928 2329 140952295 140950861 0.000000e+00 2010.0
27 TraesCS7D01G034900 chr5D 91.823 1443 67 24 928 2329 29766716 29765284 0.000000e+00 1964.0
28 TraesCS7D01G034900 chr5D 99.426 523 3 0 1 523 511286995 511286473 0.000000e+00 950.0
29 TraesCS7D01G034900 chr5D 96.403 417 14 1 522 938 384511615 384511200 0.000000e+00 686.0
30 TraesCS7D01G034900 chr6D 92.603 1433 56 22 928 2329 297170537 297169124 0.000000e+00 2013.0
31 TraesCS7D01G034900 chr6D 92.574 1414 59 24 928 2329 446363444 446362065 0.000000e+00 1988.0
32 TraesCS7D01G034900 chr6D 99.426 523 3 0 1 523 19183305 19183827 0.000000e+00 950.0
33 TraesCS7D01G034900 chr6D 99.426 523 3 0 1 523 19190733 19191255 0.000000e+00 950.0
34 TraesCS7D01G034900 chr6D 97.362 417 10 1 522 938 297170995 297170580 0.000000e+00 708.0
35 TraesCS7D01G034900 chr3B 88.931 1319 98 23 928 2228 753430393 753429105 0.000000e+00 1583.0
36 TraesCS7D01G034900 chr5B 92.308 1079 49 6 522 1582 56336724 56337786 0.000000e+00 1502.0
37 TraesCS7D01G034900 chr4A 95.107 797 29 6 1544 2332 129032019 129032813 0.000000e+00 1247.0
38 TraesCS7D01G034900 chr3D 95.063 790 30 7 1545 2329 57608766 57609551 0.000000e+00 1234.0
39 TraesCS7D01G034900 chr6A 85.057 174 13 6 2172 2333 154737622 154737450 5.250000e-37 165.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G034900 chr7D 17925284 17927658 2374 True 4386.0 4386 100.0000 1 2375 1 chr7D.!!$R2 2374
1 TraesCS7D01G034900 chr7D 106584516 106585042 526 True 952.0 952 99.2410 1 527 1 chr7D.!!$R4 526
2 TraesCS7D01G034900 chr7D 1712211 1712736 525 True 950.0 950 99.2410 1 527 1 chr7D.!!$R1 526
3 TraesCS7D01G034900 chr7D 18904996 18905525 529 True 950.0 950 99.0570 1 528 1 chr7D.!!$R3 527
4 TraesCS7D01G034900 chr2D 645234329 645236160 1831 True 2913.0 2913 95.5790 522 2329 1 chr2D.!!$R1 1807
5 TraesCS7D01G034900 chr3A 615134412 615136216 1804 True 2811.0 2811 94.7920 522 2331 1 chr3A.!!$R1 1809
6 TraesCS7D01G034900 chr3A 702241641 702243036 1395 False 1930.0 1930 91.6730 928 2329 1 chr3A.!!$F1 1401
7 TraesCS7D01G034900 chr4D 236670317 236672154 1837 True 2708.0 2708 93.5640 522 2329 1 chr4D.!!$R1 1807
8 TraesCS7D01G034900 chr1D 463791315 463793140 1825 True 2675.0 2675 93.3300 522 2330 1 chr1D.!!$R3 1808
9 TraesCS7D01G034900 chr1D 1731752 1732274 522 True 950.0 950 99.4260 1 523 1 chr1D.!!$R1 522
10 TraesCS7D01G034900 chr1D 10485291 10485813 522 False 950.0 950 99.4260 1 523 1 chr1D.!!$F1 522
11 TraesCS7D01G034900 chr1D 11943746 11944268 522 True 950.0 950 99.4260 1 523 1 chr1D.!!$R2 522
12 TraesCS7D01G034900 chr2A 610789745 610791550 1805 False 2501.0 2501 91.8160 522 2329 1 chr2A.!!$F1 1807
13 TraesCS7D01G034900 chr7A 56074402 56076222 1820 False 2459.0 2459 91.3070 522 2329 1 chr7A.!!$F1 1807
14 TraesCS7D01G034900 chr5A 235675598 235677417 1819 False 2453.0 2453 91.2670 522 2329 1 chr5A.!!$F1 1807
15 TraesCS7D01G034900 chr5D 140950861 140952295 1434 True 2010.0 2010 92.3720 928 2329 1 chr5D.!!$R2 1401
16 TraesCS7D01G034900 chr5D 29765284 29766716 1432 True 1964.0 1964 91.8230 928 2329 1 chr5D.!!$R1 1401
17 TraesCS7D01G034900 chr5D 384509734 384511615 1881 True 1358.0 2030 94.5430 522 2332 2 chr5D.!!$R4 1810
18 TraesCS7D01G034900 chr5D 511286473 511286995 522 True 950.0 950 99.4260 1 523 1 chr5D.!!$R3 522
19 TraesCS7D01G034900 chr6D 446362065 446363444 1379 True 1988.0 1988 92.5740 928 2329 1 chr6D.!!$R1 1401
20 TraesCS7D01G034900 chr6D 297169124 297170995 1871 True 1360.5 2013 94.9825 522 2329 2 chr6D.!!$R2 1807
21 TraesCS7D01G034900 chr6D 19183305 19183827 522 False 950.0 950 99.4260 1 523 1 chr6D.!!$F1 522
22 TraesCS7D01G034900 chr6D 19190733 19191255 522 False 950.0 950 99.4260 1 523 1 chr6D.!!$F2 522
23 TraesCS7D01G034900 chr3B 753429105 753430393 1288 True 1583.0 1583 88.9310 928 2228 1 chr3B.!!$R1 1300
24 TraesCS7D01G034900 chr5B 56336724 56337786 1062 False 1502.0 1502 92.3080 522 1582 1 chr5B.!!$F1 1060
25 TraesCS7D01G034900 chr4A 129032019 129032813 794 False 1247.0 1247 95.1070 1544 2332 1 chr4A.!!$F1 788
26 TraesCS7D01G034900 chr3D 57608766 57609551 785 False 1234.0 1234 95.0630 1545 2329 1 chr3D.!!$F1 784

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
409 410 3.263489 TCGTCATCGACTCTACTTCCT 57.737 47.619 0.0 0.0 41.35 3.36 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1828 2012 0.034756 AATTTGGGCCTTGGCGTTTC 59.965 50.0 4.53 0.0 0.0 2.78 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
409 410 3.263489 TCGTCATCGACTCTACTTCCT 57.737 47.619 0.00 0.00 41.35 3.36
960 1023 7.008628 GGTTTGCAAAATGTGAAATAGATCTCG 59.991 37.037 14.67 0.00 0.00 4.04
1075 1138 4.935702 TGCTCAAATTGTTGAAGAAGTGG 58.064 39.130 0.00 0.00 43.18 4.00
1077 1140 4.741676 GCTCAAATTGTTGAAGAAGTGGTG 59.258 41.667 0.00 0.00 43.18 4.17
1232 1295 2.854963 TCAAGCTGAAGTGATGCAAGT 58.145 42.857 0.00 0.00 0.00 3.16
1399 1462 5.827797 TGGCTATGAAGTTTGTCTTTGAACT 59.172 36.000 0.00 0.00 37.69 3.01
1456 1519 3.382546 TGGGAAGTTATGTCGTAGTAGGC 59.617 47.826 0.00 0.00 0.00 3.93
1582 1697 5.009610 GCTCATTTTGGAACCAGTGAACTTA 59.990 40.000 0.00 0.00 0.00 2.24
1594 1710 4.946157 CCAGTGAACTTAGATGGCTCATTT 59.054 41.667 0.00 0.00 0.00 2.32
1816 2000 3.733443 AAAGTTGGTAAAAGGCTGCAG 57.267 42.857 10.11 10.11 0.00 4.41
1832 2016 3.922850 GCTGCAGCCAAGAAAATAGAAAC 59.077 43.478 28.76 0.00 34.31 2.78
2300 2519 8.950859 ATGACCATTCAGTGACCAATAGTGGTA 61.951 40.741 16.13 0.00 46.84 3.25
2333 2552 7.660208 AGTTGAAATATTTCTTGTAGTGTCGGT 59.340 33.333 24.77 0.00 38.02 4.69
2334 2553 7.359262 TGAAATATTTCTTGTAGTGTCGGTG 57.641 36.000 24.77 0.00 38.02 4.94
2335 2554 6.370442 TGAAATATTTCTTGTAGTGTCGGTGG 59.630 38.462 24.77 0.00 38.02 4.61
2336 2555 5.670792 ATATTTCTTGTAGTGTCGGTGGA 57.329 39.130 0.00 0.00 0.00 4.02
2337 2556 3.380479 TTTCTTGTAGTGTCGGTGGAG 57.620 47.619 0.00 0.00 0.00 3.86
2338 2557 0.601558 TCTTGTAGTGTCGGTGGAGC 59.398 55.000 0.00 0.00 0.00 4.70
2339 2558 0.732880 CTTGTAGTGTCGGTGGAGCG 60.733 60.000 0.00 0.00 0.00 5.03
2340 2559 1.457823 TTGTAGTGTCGGTGGAGCGT 61.458 55.000 0.00 0.00 0.00 5.07
2341 2560 1.154073 GTAGTGTCGGTGGAGCGTC 60.154 63.158 0.00 0.00 0.00 5.19
2342 2561 1.601477 TAGTGTCGGTGGAGCGTCA 60.601 57.895 0.00 0.00 0.00 4.35
2343 2562 1.583495 TAGTGTCGGTGGAGCGTCAG 61.583 60.000 0.00 0.00 0.00 3.51
2344 2563 3.680786 TGTCGGTGGAGCGTCAGG 61.681 66.667 0.00 0.00 0.00 3.86
2345 2564 4.436998 GTCGGTGGAGCGTCAGGG 62.437 72.222 0.00 0.00 0.00 4.45
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
221 222 0.959372 ACTCGAACGGTCACTCGGAT 60.959 55.000 0.00 0.00 35.76 4.18
409 410 0.956902 TACCGACTCGTAGTGCAGCA 60.957 55.000 0.00 0.00 0.00 4.41
535 536 0.896923 TGAATCAAACAGGGCATGGC 59.103 50.000 11.56 11.56 0.00 4.40
727 738 4.576463 AGCCGATCATCAAACTAACATTCC 59.424 41.667 0.00 0.00 0.00 3.01
926 989 4.154918 TCACATTTTGCAAACCAAACCAAC 59.845 37.500 12.39 0.00 42.81 3.77
960 1023 5.048434 GGAGGAAAATGATAGGCATTAGTGC 60.048 44.000 0.74 0.74 46.25 4.40
1075 1138 2.814280 TCCTTGACTTCGGTCTTCAC 57.186 50.000 0.00 0.00 44.70 3.18
1077 1140 2.480802 GCTTTCCTTGACTTCGGTCTTC 59.519 50.000 0.00 0.00 44.70 2.87
1110 1173 2.042162 AGATGACTGGAGCCCAACATTT 59.958 45.455 11.66 6.63 33.36 2.32
1232 1295 5.427378 TCATCTTGATTGTCGCCAATTCTA 58.573 37.500 0.00 0.00 41.37 2.10
1269 1332 3.620187 CTTGTCGCGTGCAGCTTCG 62.620 63.158 5.77 0.00 45.59 3.79
1399 1462 3.187022 CGACAAACTGCATCAGATCACAA 59.813 43.478 0.29 0.00 35.18 3.33
1582 1697 3.094572 CTGGTTCCAAAATGAGCCATCT 58.905 45.455 0.00 0.00 43.53 2.90
1594 1710 3.358111 TCACAAGTTCACTGGTTCCAA 57.642 42.857 0.00 0.00 0.00 3.53
1816 2000 3.569250 TGGCGTTTCTATTTTCTTGGC 57.431 42.857 0.00 0.00 0.00 4.52
1828 2012 0.034756 AATTTGGGCCTTGGCGTTTC 59.965 50.000 4.53 0.00 0.00 2.78
1832 2016 1.135112 GTTCTAATTTGGGCCTTGGCG 60.135 52.381 4.53 0.00 0.00 5.69
2313 2532 6.045072 TCCACCGACACTACAAGAAATATT 57.955 37.500 0.00 0.00 0.00 1.28


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.