Multiple sequence alignment - TraesCS7D01G030500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G030500 chr7D 100.000 3092 0 0 1 3092 16061501 16058410 0.000000e+00 5710.0
1 TraesCS7D01G030500 chr7D 76.638 916 180 21 1313 2201 15920411 15919503 2.790000e-130 475.0
2 TraesCS7D01G030500 chr7D 89.254 335 16 2 2767 3091 16007627 16007303 4.800000e-108 401.0
3 TraesCS7D01G030500 chr7D 88.955 335 17 2 2767 3091 16016218 16015894 2.230000e-106 396.0
4 TraesCS7D01G030500 chr7D 88.657 335 18 2 2767 3091 16019972 16019648 1.040000e-104 390.0
5 TraesCS7D01G030500 chr7A 94.849 2912 101 10 228 3092 14897302 14894393 0.000000e+00 4501.0
6 TraesCS7D01G030500 chr7A 80.618 712 135 3 1304 2014 91294607 91295316 5.830000e-152 547.0
7 TraesCS7D01G030500 chr7A 79.944 718 140 4 1303 2018 14773824 14773109 2.730000e-145 525.0
8 TraesCS7D01G030500 chr7A 79.832 119 20 4 1144 1260 5108995 5109111 1.980000e-12 84.2
9 TraesCS7D01G030500 chr7A 85.897 78 11 0 2016 2093 14820366 14820289 1.980000e-12 84.2
10 TraesCS7D01G030500 chr7B 93.205 2134 114 16 835 2941 711433939 711431810 0.000000e+00 3109.0
11 TraesCS7D01G030500 chr7B 88.259 741 54 11 113 825 711434722 711433987 0.000000e+00 856.0
12 TraesCS7D01G030500 chr7B 93.077 130 9 0 2963 3092 711431688 711431559 1.130000e-44 191.0
13 TraesCS7D01G030500 chr4A 91.840 2206 136 22 860 3034 718967831 718970023 0.000000e+00 3037.0
14 TraesCS7D01G030500 chr4A 91.840 2206 136 22 860 3034 718980078 718982270 0.000000e+00 3037.0
15 TraesCS7D01G030500 chr4A 79.804 713 127 14 1312 2015 719016724 719017428 1.280000e-138 503.0
16 TraesCS7D01G030500 chr4A 80.672 119 16 4 2517 2630 719121040 719121156 5.490000e-13 86.1
17 TraesCS7D01G030500 chr3D 98.877 1603 7 2 1500 3092 584823548 584825149 0.000000e+00 2850.0
18 TraesCS7D01G030500 chr3D 99.069 1504 11 1 1 1504 584816880 584818380 0.000000e+00 2697.0
19 TraesCS7D01G030500 chr3D 79.526 718 137 8 1303 2015 584864863 584865575 1.280000e-138 503.0
20 TraesCS7D01G030500 chr3D 76.309 401 72 12 1799 2180 584888863 584889259 3.150000e-45 193.0
21 TraesCS7D01G030500 chrUn 88.663 344 19 2 2758 3091 457338120 457338453 4.800000e-108 401.0
22 TraesCS7D01G030500 chrUn 89.254 335 16 2 2767 3091 462295653 462295329 4.800000e-108 401.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G030500 chr7D 16058410 16061501 3091 True 5710.000000 5710 100.000000 1 3092 1 chr7D.!!$R3 3091
1 TraesCS7D01G030500 chr7D 15919503 15920411 908 True 475.000000 475 76.638000 1313 2201 1 chr7D.!!$R1 888
2 TraesCS7D01G030500 chr7D 16015894 16019972 4078 True 393.000000 396 88.806000 2767 3091 2 chr7D.!!$R4 324
3 TraesCS7D01G030500 chr7A 14894393 14897302 2909 True 4501.000000 4501 94.849000 228 3092 1 chr7A.!!$R3 2864
4 TraesCS7D01G030500 chr7A 91294607 91295316 709 False 547.000000 547 80.618000 1304 2014 1 chr7A.!!$F2 710
5 TraesCS7D01G030500 chr7A 14773109 14773824 715 True 525.000000 525 79.944000 1303 2018 1 chr7A.!!$R1 715
6 TraesCS7D01G030500 chr7B 711431559 711434722 3163 True 1385.333333 3109 91.513667 113 3092 3 chr7B.!!$R1 2979
7 TraesCS7D01G030500 chr4A 718967831 718970023 2192 False 3037.000000 3037 91.840000 860 3034 1 chr4A.!!$F1 2174
8 TraesCS7D01G030500 chr4A 718980078 718982270 2192 False 3037.000000 3037 91.840000 860 3034 1 chr4A.!!$F2 2174
9 TraesCS7D01G030500 chr4A 719016724 719017428 704 False 503.000000 503 79.804000 1312 2015 1 chr4A.!!$F3 703
10 TraesCS7D01G030500 chr3D 584823548 584825149 1601 False 2850.000000 2850 98.877000 1500 3092 1 chr3D.!!$F2 1592
11 TraesCS7D01G030500 chr3D 584816880 584818380 1500 False 2697.000000 2697 99.069000 1 1504 1 chr3D.!!$F1 1503
12 TraesCS7D01G030500 chr3D 584864863 584865575 712 False 503.000000 503 79.526000 1303 2015 1 chr3D.!!$F3 712

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
71 72 1.202758 TGAAACGCCATGTCTCCTTGT 60.203 47.619 0.0 0.0 0.0 3.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2348 2455 5.794687 TGAACGCGAATTAATCACAGAAT 57.205 34.783 15.93 0.0 0.0 2.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
48 49 2.593468 TAGGGCGCACTCAAGGATGC 62.593 60.000 19.71 0.0 38.52 3.91
71 72 1.202758 TGAAACGCCATGTCTCCTTGT 60.203 47.619 0.00 0.0 0.00 3.16
310 321 7.719633 GCATGGAGGTATTTGACTAAAATAGGA 59.280 37.037 0.00 0.0 40.59 2.94
638 651 3.006940 CGAAATTACTTACAGCTGCCCA 58.993 45.455 15.27 0.0 0.00 5.36
2348 2455 2.106477 TGCGCATGTAGTGAATTCCA 57.894 45.000 5.66 0.0 0.00 3.53
2570 2685 8.550376 GTCATATTGTTTGTTGATTGTGCTTTT 58.450 29.630 0.00 0.0 0.00 2.27
2571 2686 8.549548 TCATATTGTTTGTTGATTGTGCTTTTG 58.450 29.630 0.00 0.0 0.00 2.44
2572 2687 6.981762 ATTGTTTGTTGATTGTGCTTTTGA 57.018 29.167 0.00 0.0 0.00 2.69
3036 7023 6.764308 ATATTTCAGTAAGCTGCACAATGT 57.236 33.333 1.02 0.0 42.29 2.71
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
48 49 0.652592 GGAGACATGGCGTTTCATCG 59.347 55.000 0.00 0.0 30.21 3.84
71 72 4.292186 AGAGCAACTGAAATTAGGCAGA 57.708 40.909 9.16 0.0 36.07 4.26
655 668 3.508845 AGCAGCTTTAAGGGTTCAAGA 57.491 42.857 0.00 0.0 0.00 3.02
2348 2455 5.794687 TGAACGCGAATTAATCACAGAAT 57.205 34.783 15.93 0.0 0.00 2.40
2572 2687 1.072159 GTGCTCAGGTTGAGGCACT 59.928 57.895 18.03 0.0 44.43 4.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.