Multiple sequence alignment - TraesCS7D01G030400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G030400 chr7D 100.000 2534 0 0 1 2534 15936768 15934235 0.000000e+00 4680.0
1 TraesCS7D01G030400 chr3D 99.172 2537 16 3 1 2534 584858729 584861263 0.000000e+00 4564.0
2 TraesCS7D01G030400 chr7A 96.591 2552 65 7 1 2534 14849561 14847014 0.000000e+00 4211.0
3 TraesCS7D01G030400 chr7A 78.689 305 57 7 843 1144 618676894 618677193 1.990000e-46 196.0
4 TraesCS7D01G030400 chr7A 81.373 102 13 3 2302 2401 39592306 39592209 7.520000e-11 78.7
5 TraesCS7D01G030400 chr4A 96.022 2539 81 10 1 2534 719011376 719013899 0.000000e+00 4111.0
6 TraesCS7D01G030400 chr7B 85.816 1269 157 18 107 1367 711420454 711419201 0.000000e+00 1325.0
7 TraesCS7D01G030400 chr5A 78.140 215 41 6 841 1053 18097111 18096901 5.690000e-27 132.0
8 TraesCS7D01G030400 chr6D 80.822 146 18 6 2302 2445 426103023 426102886 3.450000e-19 106.0
9 TraesCS7D01G030400 chr6B 80.272 147 17 7 2302 2445 641398011 641397874 1.600000e-17 100.0
10 TraesCS7D01G030400 chr6A 80.272 147 17 7 2302 2445 571023203 571023066 1.600000e-17 100.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G030400 chr7D 15934235 15936768 2533 True 4680 4680 100.000 1 2534 1 chr7D.!!$R1 2533
1 TraesCS7D01G030400 chr3D 584858729 584861263 2534 False 4564 4564 99.172 1 2534 1 chr3D.!!$F1 2533
2 TraesCS7D01G030400 chr7A 14847014 14849561 2547 True 4211 4211 96.591 1 2534 1 chr7A.!!$R1 2533
3 TraesCS7D01G030400 chr4A 719011376 719013899 2523 False 4111 4111 96.022 1 2534 1 chr4A.!!$F1 2533
4 TraesCS7D01G030400 chr7B 711419201 711420454 1253 True 1325 1325 85.816 107 1367 1 chr7B.!!$R1 1260

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
56 57 2.244117 GAGGGCCTGAGACATTCGCA 62.244 60.000 12.95 0.0 0.0 5.10 F
951 960 4.199310 TGGTCAGAACTCAAACTTCCTTG 58.801 43.478 0.00 0.0 0.0 3.61 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1120 1130 1.808945 GAGGAGCATGTCACCACAAAG 59.191 52.381 0.0 0.0 35.64 2.77 R
2046 2060 2.664916 CTTCCATTGGCGTTTGACTTG 58.335 47.619 0.0 0.0 0.00 3.16 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
56 57 2.244117 GAGGGCCTGAGACATTCGCA 62.244 60.000 12.95 0.00 0.00 5.10
951 960 4.199310 TGGTCAGAACTCAAACTTCCTTG 58.801 43.478 0.00 0.00 0.00 3.61
1120 1130 2.094675 ACCAAACATCATGGCTAGTGC 58.905 47.619 0.00 0.00 41.89 4.40
1683 1694 7.459795 TGTTTAATGTTGCACTGGATGAATA 57.540 32.000 0.00 0.00 0.00 1.75
1765 1779 3.947196 TCCTTGGTATTCATGCATGTGTC 59.053 43.478 25.43 14.07 0.00 3.67
2046 2060 6.168389 TCAAGGAAGGTAACCGTAATTTCTC 58.832 40.000 0.00 0.00 37.17 2.87
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
214 217 9.958180 AAATAGCATGCTATAACCATGTATACA 57.042 29.630 34.51 8.27 41.56 2.29
951 960 4.158384 CGATTTGAGTTATTGTGCACCAC 58.842 43.478 15.69 5.93 34.56 4.16
1120 1130 1.808945 GAGGAGCATGTCACCACAAAG 59.191 52.381 0.00 0.00 35.64 2.77
1683 1694 6.369065 GCTATAATTAGCTAAACGGCTCACAT 59.631 38.462 10.85 0.00 46.13 3.21
2046 2060 2.664916 CTTCCATTGGCGTTTGACTTG 58.335 47.619 0.00 0.00 0.00 3.16
2366 2393 6.257630 GGAAGTGTGCAATTGTTGTTGTTATT 59.742 34.615 7.40 0.00 0.00 1.40
2367 2394 5.752955 GGAAGTGTGCAATTGTTGTTGTTAT 59.247 36.000 7.40 0.00 0.00 1.89
2436 2463 7.148205 GGACCTTAAACGCAGGAAAACATAATA 60.148 37.037 0.00 0.00 35.14 0.98


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.