Multiple sequence alignment - TraesCS7D01G028800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G028800 chr7D 100.000 2291 0 0 1 2291 13903402 13905692 0.000000e+00 4231.0
1 TraesCS7D01G028800 chr7D 86.650 824 93 12 663 1482 520554924 520554114 0.000000e+00 896.0
2 TraesCS7D01G028800 chr7D 90.226 665 58 3 3 666 520555627 520554969 0.000000e+00 861.0
3 TraesCS7D01G028800 chr3D 98.654 1634 16 3 663 2290 585176595 585174962 0.000000e+00 2891.0
4 TraesCS7D01G028800 chr3D 98.363 672 5 1 1 666 585177311 585176640 0.000000e+00 1175.0
5 TraesCS7D01G028800 chr4D 96.825 819 25 1 663 1480 359888256 359887438 0.000000e+00 1367.0
6 TraesCS7D01G028800 chr4D 98.193 664 12 0 3 666 359888964 359888301 0.000000e+00 1160.0
7 TraesCS7D01G028800 chr7B 95.849 819 29 5 663 1479 381384940 381384125 0.000000e+00 1319.0
8 TraesCS7D01G028800 chr7B 91.076 818 69 4 663 1478 723080053 723080868 0.000000e+00 1103.0
9 TraesCS7D01G028800 chr7B 96.235 664 25 0 3 666 381385648 381384985 0.000000e+00 1088.0
10 TraesCS7D01G028800 chr7B 89.889 811 79 3 663 1472 723055381 723056189 0.000000e+00 1040.0
11 TraesCS7D01G028800 chr7B 87.942 821 90 7 663 1479 620566402 620565587 0.000000e+00 959.0
12 TraesCS7D01G028800 chr7B 92.632 665 48 1 3 666 723054672 723055336 0.000000e+00 955.0
13 TraesCS7D01G028800 chr7B 92.319 664 51 0 3 666 723079345 723080008 0.000000e+00 944.0
14 TraesCS7D01G028800 chr7B 90.950 663 56 4 5 666 620567106 620566447 0.000000e+00 889.0
15 TraesCS7D01G028800 chr4A 87.956 822 89 8 663 1479 728815619 728814803 0.000000e+00 961.0
16 TraesCS7D01G028800 chr4A 90.827 665 57 4 3 666 728816325 728815664 0.000000e+00 887.0
17 TraesCS7D01G028800 chr1B 86.602 821 87 17 663 1475 520974706 520975511 0.000000e+00 885.0
18 TraesCS7D01G028800 chr1B 87.519 665 75 4 3 666 520974004 520974661 0.000000e+00 761.0
19 TraesCS7D01G028800 chr5B 95.288 191 8 1 1289 1479 573096273 573096462 3.700000e-78 302.0
20 TraesCS7D01G028800 chr7A 84.942 259 22 4 1979 2230 13375511 13375759 1.760000e-61 246.0
21 TraesCS7D01G028800 chr2A 92.593 162 11 1 1318 1479 78587721 78587881 4.920000e-57 231.0
22 TraesCS7D01G028800 chr2A 89.831 59 2 4 2232 2287 708044986 708044929 3.160000e-09 73.1
23 TraesCS7D01G028800 chr5A 95.745 47 2 0 2241 2287 47955747 47955793 2.440000e-10 76.8
24 TraesCS7D01G028800 chr5A 94.000 50 1 2 2238 2287 559833338 559833291 8.780000e-10 75.0
25 TraesCS7D01G028800 chr5A 84.000 75 6 4 2216 2287 665426804 665426875 1.470000e-07 67.6
26 TraesCS7D01G028800 chr3B 95.745 47 2 0 2241 2287 417376432 417376478 2.440000e-10 76.8
27 TraesCS7D01G028800 chr3A 97.727 44 1 0 2244 2287 421454458 421454501 2.440000e-10 76.8
28 TraesCS7D01G028800 chr3A 94.118 51 2 1 2238 2287 477416551 477416601 2.440000e-10 76.8
29 TraesCS7D01G028800 chr3A 89.655 58 2 4 2232 2286 697782204 697782260 1.140000e-08 71.3


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G028800 chr7D 13903402 13905692 2290 False 4231.0 4231 100.0000 1 2291 1 chr7D.!!$F1 2290
1 TraesCS7D01G028800 chr7D 520554114 520555627 1513 True 878.5 896 88.4380 3 1482 2 chr7D.!!$R1 1479
2 TraesCS7D01G028800 chr3D 585174962 585177311 2349 True 2033.0 2891 98.5085 1 2290 2 chr3D.!!$R1 2289
3 TraesCS7D01G028800 chr4D 359887438 359888964 1526 True 1263.5 1367 97.5090 3 1480 2 chr4D.!!$R1 1477
4 TraesCS7D01G028800 chr7B 381384125 381385648 1523 True 1203.5 1319 96.0420 3 1479 2 chr7B.!!$R1 1476
5 TraesCS7D01G028800 chr7B 723079345 723080868 1523 False 1023.5 1103 91.6975 3 1478 2 chr7B.!!$F2 1475
6 TraesCS7D01G028800 chr7B 723054672 723056189 1517 False 997.5 1040 91.2605 3 1472 2 chr7B.!!$F1 1469
7 TraesCS7D01G028800 chr7B 620565587 620567106 1519 True 924.0 959 89.4460 5 1479 2 chr7B.!!$R2 1474
8 TraesCS7D01G028800 chr4A 728814803 728816325 1522 True 924.0 961 89.3915 3 1479 2 chr4A.!!$R1 1476
9 TraesCS7D01G028800 chr1B 520974004 520975511 1507 False 823.0 885 87.0605 3 1475 2 chr1B.!!$F1 1472

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
881 943 5.320549 ACCTCTGAAACATTGCAATCATC 57.679 39.13 9.53 8.65 0.0 2.92 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2012 2089 0.881796 GCTCATAATTAAGGGCGGGC 59.118 55.0 0.0 0.0 0.0 6.13 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
307 314 5.862323 TGACAGTGTTAAAGCTATTCGACTC 59.138 40.000 0.00 0.00 0.00 3.36
881 943 5.320549 ACCTCTGAAACATTGCAATCATC 57.679 39.130 9.53 8.65 0.00 2.92
1194 1265 0.467290 TGACCCAACAAAGGCTCACC 60.467 55.000 0.00 0.00 0.00 4.02
1529 1606 1.672145 GCCAGACACCCTCGAGTAAAC 60.672 57.143 12.31 0.00 0.00 2.01
1544 1621 6.524734 TCGAGTAAACGGGTAGTATAGATCA 58.475 40.000 0.00 0.00 0.00 2.92
1568 1645 1.351017 GGGGCCATAAGATCGATGGAA 59.649 52.381 25.61 0.00 45.89 3.53
1583 1660 2.435372 TGGAAGTTGATGCCCCATAC 57.565 50.000 0.00 0.00 0.00 2.39
1604 1681 3.056107 ACTCATGCGGGCGTAATGTATAT 60.056 43.478 0.00 0.00 0.00 0.86
1703 1780 2.989909 ACATCGTCTGCATCATTTCCA 58.010 42.857 0.00 0.00 0.00 3.53
2012 2089 9.657419 TCCTCAATAATGCACATACATATACAG 57.343 33.333 0.00 0.00 0.00 2.74
2077 2154 8.435430 GCCAACATAAAAGAAAATAGAGCAAAC 58.565 33.333 0.00 0.00 0.00 2.93
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
775 836 7.391275 TGAGAGAATTGCTTGATCAACAATACA 59.609 33.333 24.07 18.35 37.88 2.29
881 943 8.202745 AGAAGTTTTCAAGCTATTCTTATCCG 57.797 34.615 0.00 0.00 32.74 4.18
1194 1265 1.745087 AGTGCTATTGTGGCCAAATCG 59.255 47.619 7.24 7.36 33.44 3.34
1529 1606 3.510360 CCCCAGTTGATCTATACTACCCG 59.490 52.174 0.00 0.00 0.00 5.28
1544 1621 1.507140 TCGATCTTATGGCCCCAGTT 58.493 50.000 0.00 0.00 0.00 3.16
1568 1645 2.750807 GCATGAGTATGGGGCATCAACT 60.751 50.000 0.00 0.00 34.79 3.16
1583 1660 1.795768 ATACATTACGCCCGCATGAG 58.204 50.000 0.00 0.00 0.00 2.90
1703 1780 5.711506 TGTCTGTGCAGTTCAAATGGAATAT 59.288 36.000 0.00 0.00 37.93 1.28
2012 2089 0.881796 GCTCATAATTAAGGGCGGGC 59.118 55.000 0.00 0.00 0.00 6.13
2077 2154 9.490379 TCATGTCTTCATCAATCTCAATATCTG 57.510 33.333 0.00 0.00 31.15 2.90


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.