Multiple sequence alignment - TraesCS7D01G027200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G027200 chr7D 100.000 3126 0 0 1 3126 13373059 13376184 0 5773
1 TraesCS7D01G027200 chr7D 98.437 2303 29 4 826 3126 602036007 602033710 0 4047
2 TraesCS7D01G027200 chr7D 96.970 825 25 0 1 825 471142813 471143637 0 1386
3 TraesCS7D01G027200 chr7D 96.970 825 22 2 4 825 205222611 205221787 0 1382
4 TraesCS7D01G027200 chr1D 98.306 2302 33 3 826 3126 462972046 462974342 0 4030
5 TraesCS7D01G027200 chr1D 98.219 2302 35 3 826 3126 339309752 339312048 0 4019
6 TraesCS7D01G027200 chr1D 98.132 2302 38 2 826 3126 232137192 232134895 0 4008
7 TraesCS7D01G027200 chr1D 96.856 827 24 2 1 825 207027109 207026283 0 1382
8 TraesCS7D01G027200 chr1D 96.970 825 21 4 4 825 207032693 207031870 0 1382
9 TraesCS7D01G027200 chr2D 98.175 2302 37 2 826 3126 437672284 437669987 0 4013
10 TraesCS7D01G027200 chr2D 98.003 2304 37 5 826 3126 606585277 606582980 0 3991
11 TraesCS7D01G027200 chr4D 98.089 2302 37 4 826 3126 461817940 461820235 0 4000
12 TraesCS7D01G027200 chr4D 96.318 842 27 4 4 841 486559840 486558999 0 1380
13 TraesCS7D01G027200 chr3D 98.089 2302 37 4 826 3126 58420135 58422430 0 4000
14 TraesCS7D01G027200 chr3D 98.003 2303 38 4 826 3126 557717913 557715617 0 3991
15 TraesCS7D01G027200 chr5D 97.098 827 21 3 1 825 526025696 526026521 0 1391
16 TraesCS7D01G027200 chr5D 97.094 826 20 3 4 825 5891363 5890538 0 1389
17 TraesCS7D01G027200 chr5D 96.852 826 25 1 1 825 373123371 373124196 0 1380
18 TraesCS7D01G027200 chr5D 96.735 827 24 3 1 825 413782788 413783613 0 1375


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G027200 chr7D 13373059 13376184 3125 False 5773 5773 100.000 1 3126 1 chr7D.!!$F1 3125
1 TraesCS7D01G027200 chr7D 602033710 602036007 2297 True 4047 4047 98.437 826 3126 1 chr7D.!!$R2 2300
2 TraesCS7D01G027200 chr7D 471142813 471143637 824 False 1386 1386 96.970 1 825 1 chr7D.!!$F2 824
3 TraesCS7D01G027200 chr7D 205221787 205222611 824 True 1382 1382 96.970 4 825 1 chr7D.!!$R1 821
4 TraesCS7D01G027200 chr1D 462972046 462974342 2296 False 4030 4030 98.306 826 3126 1 chr1D.!!$F2 2300
5 TraesCS7D01G027200 chr1D 339309752 339312048 2296 False 4019 4019 98.219 826 3126 1 chr1D.!!$F1 2300
6 TraesCS7D01G027200 chr1D 232134895 232137192 2297 True 4008 4008 98.132 826 3126 1 chr1D.!!$R3 2300
7 TraesCS7D01G027200 chr1D 207026283 207027109 826 True 1382 1382 96.856 1 825 1 chr1D.!!$R1 824
8 TraesCS7D01G027200 chr1D 207031870 207032693 823 True 1382 1382 96.970 4 825 1 chr1D.!!$R2 821
9 TraesCS7D01G027200 chr2D 437669987 437672284 2297 True 4013 4013 98.175 826 3126 1 chr2D.!!$R1 2300
10 TraesCS7D01G027200 chr2D 606582980 606585277 2297 True 3991 3991 98.003 826 3126 1 chr2D.!!$R2 2300
11 TraesCS7D01G027200 chr4D 461817940 461820235 2295 False 4000 4000 98.089 826 3126 1 chr4D.!!$F1 2300
12 TraesCS7D01G027200 chr4D 486558999 486559840 841 True 1380 1380 96.318 4 841 1 chr4D.!!$R1 837
13 TraesCS7D01G027200 chr3D 58420135 58422430 2295 False 4000 4000 98.089 826 3126 1 chr3D.!!$F1 2300
14 TraesCS7D01G027200 chr3D 557715617 557717913 2296 True 3991 3991 98.003 826 3126 1 chr3D.!!$R1 2300
15 TraesCS7D01G027200 chr5D 526025696 526026521 825 False 1391 1391 97.098 1 825 1 chr5D.!!$F3 824
16 TraesCS7D01G027200 chr5D 5890538 5891363 825 True 1389 1389 97.094 4 825 1 chr5D.!!$R1 821
17 TraesCS7D01G027200 chr5D 373123371 373124196 825 False 1380 1380 96.852 1 825 1 chr5D.!!$F1 824
18 TraesCS7D01G027200 chr5D 413782788 413783613 825 False 1375 1375 96.735 1 825 1 chr5D.!!$F2 824

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
282 285 2.170607 CGCCAAGAGATAAGGGAAAGGA 59.829 50.000 0.00 0.00 0.00 3.36 F
376 379 2.860971 AGGAAGGGCCAAGGCTGT 60.861 61.111 11.40 0.00 41.60 4.40 F
406 413 4.557705 TCTCCCTTGGCCCTATATATAGC 58.442 47.826 13.49 5.04 0.00 2.97 F
1349 1361 2.224523 TGAGGTTTGCGGACTTCAAGAT 60.225 45.455 0.00 0.00 33.39 2.40 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1270 1282 0.394938 TACTTCAGCCGCTCAAACCA 59.605 50.000 0.00 0.0 0.00 3.67 R
1349 1361 1.003812 CCGAATTGTACTCCCCAACCA 59.996 52.381 0.00 0.0 0.00 3.67 R
1837 1852 1.071471 CTGAACCAAGGCGAGGTGT 59.929 57.895 4.67 0.0 39.86 4.16 R
3029 3046 0.846427 TGAGGGGCTGAATTGGACCT 60.846 55.000 0.00 0.0 31.26 3.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
170 171 3.572222 GTCCGGGGGTCCACCAAA 61.572 66.667 11.81 0.00 42.91 3.28
282 285 2.170607 CGCCAAGAGATAAGGGAAAGGA 59.829 50.000 0.00 0.00 0.00 3.36
376 379 2.860971 AGGAAGGGCCAAGGCTGT 60.861 61.111 11.40 0.00 41.60 4.40
406 413 4.557705 TCTCCCTTGGCCCTATATATAGC 58.442 47.826 13.49 5.04 0.00 2.97
645 654 4.781959 CCGTCCGTTCGGCGCTAA 62.782 66.667 7.64 0.00 43.96 3.09
775 787 7.839680 TGTTGCTAGATGACTCCATAGATTA 57.160 36.000 0.00 0.00 32.09 1.75
1349 1361 2.224523 TGAGGTTTGCGGACTTCAAGAT 60.225 45.455 0.00 0.00 33.39 2.40
1837 1852 4.717629 CGGAAGGCGCGTGAGACA 62.718 66.667 8.43 0.00 0.00 3.41
2092 2107 2.039418 ACTAGTATGGAGATTGCGGCA 58.961 47.619 0.00 0.00 0.00 5.69
2423 2439 3.882888 CGCCACCACTCATACCATTTTAT 59.117 43.478 0.00 0.00 0.00 1.40
2654 2671 3.877559 TGCTGAGACCGATGATGAAAAT 58.122 40.909 0.00 0.00 0.00 1.82
2768 2785 2.829914 ATCGTAGCACCGCCCGTA 60.830 61.111 0.00 0.00 0.00 4.02
2802 2819 6.092955 TCAAGACCGTTTTTAGAAGCTCTA 57.907 37.500 0.00 0.00 0.00 2.43
2968 2985 4.349930 GGGGAAGTTAGTCATTAGGCCATA 59.650 45.833 5.01 0.00 0.00 2.74
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
23 24 0.806102 GTGACGTCCGGGATCACATG 60.806 60.000 20.66 0.0 41.94 3.21
27 28 2.360225 TCGTGACGTCCGGGATCA 60.360 61.111 20.97 0.0 0.00 2.92
257 260 2.325484 TCCCTTATCTCTTGGCGCATA 58.675 47.619 10.83 0.0 0.00 3.14
282 285 2.563406 CCTTCCCCCTTTAGGACTCTT 58.437 52.381 0.00 0.0 38.24 2.85
645 654 4.694760 TGATCCAAATCACCGATGATCT 57.305 40.909 0.00 0.0 45.26 2.75
775 787 6.515272 AATTTTCTACGCATCACCAAGATT 57.485 33.333 0.00 0.0 33.72 2.40
1270 1282 0.394938 TACTTCAGCCGCTCAAACCA 59.605 50.000 0.00 0.0 0.00 3.67
1321 1333 2.027625 CCGCAAACCTCAGACGGAC 61.028 63.158 0.00 0.0 46.71 4.79
1349 1361 1.003812 CCGAATTGTACTCCCCAACCA 59.996 52.381 0.00 0.0 0.00 3.67
1837 1852 1.071471 CTGAACCAAGGCGAGGTGT 59.929 57.895 4.67 0.0 39.86 4.16
2768 2785 3.097342 ACGGTCTTGAGGGTAGTGTAT 57.903 47.619 0.00 0.0 0.00 2.29
3029 3046 0.846427 TGAGGGGCTGAATTGGACCT 60.846 55.000 0.00 0.0 31.26 3.85
3053 3071 1.127951 CACCATGAAGTACCGAAACGC 59.872 52.381 0.00 0.0 0.00 4.84


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.