Multiple sequence alignment - TraesCS7D01G021400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G021400 chr7D 100.000 3170 0 0 1 3170 10048267 10051436 0.000000e+00 5854.0
1 TraesCS7D01G021400 chr7D 96.028 3197 89 23 1 3170 237846569 237849754 0.000000e+00 5166.0
2 TraesCS7D01G021400 chr7D 94.618 3196 118 33 1 3170 308587844 308591011 0.000000e+00 4900.0
3 TraesCS7D01G021400 chr7D 90.836 371 17 12 1 363 201182309 201182670 6.150000e-132 481.0
4 TraesCS7D01G021400 chr2D 96.392 3187 79 9 1 3170 105584326 105587493 0.000000e+00 5216.0
5 TraesCS7D01G021400 chr2D 94.234 3191 112 36 1 3170 62399562 62396423 0.000000e+00 4807.0
6 TraesCS7D01G021400 chr2D 96.300 2919 73 12 254 3170 368812233 368815118 0.000000e+00 4759.0
7 TraesCS7D01G021400 chr2D 97.538 2762 50 10 412 3170 421784364 421787110 0.000000e+00 4708.0
8 TraesCS7D01G021400 chr2D 96.821 2611 73 3 560 3170 86500669 86503269 0.000000e+00 4353.0
9 TraesCS7D01G021400 chr2D 88.079 453 35 13 1 439 260026425 260025978 1.300000e-143 520.0
10 TraesCS7D01G021400 chr2D 90.582 361 28 4 1 359 368811909 368812265 1.030000e-129 473.0
11 TraesCS7D01G021400 chr4D 95.573 3185 103 24 1 3170 72250907 72254068 0.000000e+00 5066.0
12 TraesCS7D01G021400 chr4D 94.536 3221 100 49 1 3170 85503386 85500191 0.000000e+00 4903.0
13 TraesCS7D01G021400 chr4D 97.205 2755 74 3 413 3166 9330364 9333116 0.000000e+00 4658.0
14 TraesCS7D01G021400 chr5D 95.109 3210 106 34 1 3170 73411824 73415022 0.000000e+00 5011.0
15 TraesCS7D01G021400 chr5D 95.627 2973 81 28 201 3170 334943104 334940178 0.000000e+00 4724.0
16 TraesCS7D01G021400 chr5D 96.587 293 8 1 1 293 334943357 334943067 4.750000e-133 484.0
17 TraesCS7D01G021400 chr1D 95.317 3011 95 36 191 3170 485036389 485033394 0.000000e+00 4737.0
18 TraesCS7D01G021400 chr1D 95.918 294 10 1 1 294 85512772 85513063 2.860000e-130 475.0
19 TraesCS7D01G021400 chr3D 95.593 295 9 2 1 293 575229178 575228886 1.330000e-128 470.0
20 TraesCS7D01G021400 chr3D 80.000 95 9 7 307 395 19199091 19199181 9.490000e-06 62.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G021400 chr7D 10048267 10051436 3169 False 5854 5854 100.000 1 3170 1 chr7D.!!$F1 3169
1 TraesCS7D01G021400 chr7D 237846569 237849754 3185 False 5166 5166 96.028 1 3170 1 chr7D.!!$F3 3169
2 TraesCS7D01G021400 chr7D 308587844 308591011 3167 False 4900 4900 94.618 1 3170 1 chr7D.!!$F4 3169
3 TraesCS7D01G021400 chr2D 105584326 105587493 3167 False 5216 5216 96.392 1 3170 1 chr2D.!!$F2 3169
4 TraesCS7D01G021400 chr2D 62396423 62399562 3139 True 4807 4807 94.234 1 3170 1 chr2D.!!$R1 3169
5 TraesCS7D01G021400 chr2D 421784364 421787110 2746 False 4708 4708 97.538 412 3170 1 chr2D.!!$F3 2758
6 TraesCS7D01G021400 chr2D 86500669 86503269 2600 False 4353 4353 96.821 560 3170 1 chr2D.!!$F1 2610
7 TraesCS7D01G021400 chr2D 368811909 368815118 3209 False 2616 4759 93.441 1 3170 2 chr2D.!!$F4 3169
8 TraesCS7D01G021400 chr4D 72250907 72254068 3161 False 5066 5066 95.573 1 3170 1 chr4D.!!$F2 3169
9 TraesCS7D01G021400 chr4D 85500191 85503386 3195 True 4903 4903 94.536 1 3170 1 chr4D.!!$R1 3169
10 TraesCS7D01G021400 chr4D 9330364 9333116 2752 False 4658 4658 97.205 413 3166 1 chr4D.!!$F1 2753
11 TraesCS7D01G021400 chr5D 73411824 73415022 3198 False 5011 5011 95.109 1 3170 1 chr5D.!!$F1 3169
12 TraesCS7D01G021400 chr5D 334940178 334943357 3179 True 2604 4724 96.107 1 3170 2 chr5D.!!$R1 3169
13 TraesCS7D01G021400 chr1D 485033394 485036389 2995 True 4737 4737 95.317 191 3170 1 chr1D.!!$R1 2979

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
708 1130 1.048601 TTCTTTCTGGCGAGGTCTGT 58.951 50.0 0.0 0.0 0.0 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2531 2954 0.946221 AGCGGAGTCAGCACGAAAAG 60.946 55.0 17.72 0.0 37.01 2.27 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
445 792 2.279517 GTATCGCGCTCCCCTGTG 60.280 66.667 5.56 0.0 0.00 3.66
683 1105 2.049767 TGCGTGGCATCCGTCTCTA 61.050 57.895 0.00 0.0 31.71 2.43
708 1130 1.048601 TTCTTTCTGGCGAGGTCTGT 58.951 50.000 0.00 0.0 0.00 3.41
877 1299 3.118000 TGAGGAGGCTCTTCAGACGTATA 60.118 47.826 23.68 0.2 29.68 1.47
1057 1479 7.038729 CCTCTGGTGATGCCTTATATCTTTCTA 60.039 40.741 0.00 0.0 38.35 2.10
1795 2217 9.170734 CTTTTCATATGTCTTCTCATTCTTCCA 57.829 33.333 1.90 0.0 0.00 3.53
1909 2331 9.543231 TTTCTACTCCTTCTTATTCTGTTCCTA 57.457 33.333 0.00 0.0 0.00 2.94
2111 2533 1.377725 ATGTTCCTTCCGCTGCCAG 60.378 57.895 0.00 0.0 0.00 4.85
2144 2566 2.181777 CTCCGCTGCTGTCGCTTA 59.818 61.111 0.00 0.0 36.97 3.09
2179 2601 3.531934 TCAAGCAGTGACATCATCGAT 57.468 42.857 0.00 0.0 0.00 3.59
2365 2787 3.137176 AGTCCATTCTGATGTATGGGGTG 59.863 47.826 6.94 0.0 40.28 4.61
2531 2954 1.464997 GTTCTCTTCACCCATTCGTGC 59.535 52.381 0.00 0.0 33.57 5.34
2659 3082 1.595382 GGTGTGTCTGAGCGCAAGT 60.595 57.895 11.47 0.0 41.68 3.16
2725 3148 2.162681 CTCTTCCGCCTCATTTTTGGT 58.837 47.619 0.00 0.0 0.00 3.67
3150 3573 1.204113 CCTCTGCTTCTCCACCCCTT 61.204 60.000 0.00 0.0 0.00 3.95
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
683 1105 0.035458 CTCGCCAGAAAGAACACCCT 59.965 55.000 0.00 0.00 0.00 4.34
737 1159 2.439883 GAGTCGGCGGAGTAGGGT 60.440 66.667 7.21 0.00 0.00 4.34
877 1299 4.644685 AGTGTAAACAGACAAAGCACCATT 59.355 37.500 0.00 0.00 0.00 3.16
1057 1479 0.745845 GCATGCTCCTGACGAACCAT 60.746 55.000 11.37 0.00 0.00 3.55
1377 1799 1.001633 GTGGAAGAAACCCGAGTAGCA 59.998 52.381 0.00 0.00 0.00 3.49
1795 2217 2.667137 CGAGCGAAGAGAAGACAAAGT 58.333 47.619 0.00 0.00 0.00 2.66
1859 2281 3.107601 TGGCCTCTACTAGCAACAGAAT 58.892 45.455 3.32 0.00 0.00 2.40
1909 2331 2.744202 GTCGAGGAACATGAGCAACATT 59.256 45.455 0.00 0.00 37.07 2.71
2051 2473 2.579201 CCTGAGAATCACGGCGGT 59.421 61.111 13.24 0.00 42.56 5.68
2111 2533 2.045926 AGGAACTGGCGATGGTGC 60.046 61.111 0.00 0.00 37.18 5.01
2144 2566 4.074970 CTGCTTGAAGGAACCAGTAACAT 58.925 43.478 0.00 0.00 0.00 2.71
2169 2591 4.573607 CACAGATGACCAAATCGATGATGT 59.426 41.667 0.00 0.00 0.00 3.06
2179 2601 3.476552 GAGAACCACACAGATGACCAAA 58.523 45.455 0.00 0.00 0.00 3.28
2365 2787 0.949105 TTCGAAGTGAAAGGAGCCGC 60.949 55.000 0.00 0.00 32.37 6.53
2531 2954 0.946221 AGCGGAGTCAGCACGAAAAG 60.946 55.000 17.72 0.00 37.01 2.27
2610 3033 1.980765 TGAGCACCAGGACAAGAGAAT 59.019 47.619 0.00 0.00 0.00 2.40
2725 3148 1.215673 AGAAGTGGAGATAGCCTCGGA 59.784 52.381 0.00 0.00 42.89 4.55
2994 3417 4.031089 CGAGACTCATCAAAAGTCACATCG 59.969 45.833 2.82 3.29 44.54 3.84
3150 3573 2.047655 GGTGGCGGTGAATCGACA 60.048 61.111 0.00 0.00 46.92 4.35


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.