Multiple sequence alignment - TraesCS7D01G005700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G005700 chr7D 100.000 3122 0 0 1 3122 2751264 2748143 0.000000e+00 5766
1 TraesCS7D01G005700 chr7D 96.469 1756 52 4 1021 2772 629750562 629748813 0.000000e+00 2891
2 TraesCS7D01G005700 chr2D 95.636 3139 112 9 1 3122 53044736 53041606 0.000000e+00 5014
3 TraesCS7D01G005700 chr5D 97.582 1820 36 5 1307 3122 249071893 249070078 0.000000e+00 3110
4 TraesCS7D01G005700 chr5D 96.221 1032 33 6 7 1037 249073170 249072144 0.000000e+00 1685
5 TraesCS7D01G005700 chr5D 95.902 122 4 1 2526 2647 459348691 459348571 2.460000e-46 196
6 TraesCS7D01G005700 chr1A 96.277 1343 37 3 1792 3122 9482486 9481145 0.000000e+00 2191
7 TraesCS7D01G005700 chr1A 89.816 923 85 5 10 926 67964619 67963700 0.000000e+00 1175
8 TraesCS7D01G005700 chr3A 91.311 1243 85 12 7 1232 480625636 480626872 0.000000e+00 1676
9 TraesCS7D01G005700 chr3A 94.807 828 27 4 1723 2549 480634707 480635519 0.000000e+00 1277
10 TraesCS7D01G005700 chr3A 94.553 514 23 2 2613 3122 548587940 548588452 0.000000e+00 789
11 TraesCS7D01G005700 chr3A 96.454 141 5 0 1506 1646 480634567 480634707 1.870000e-57 233
12 TraesCS7D01G005700 chr4B 94.995 1039 42 5 2088 3122 201661839 201660807 0.000000e+00 1622
13 TraesCS7D01G005700 chr4B 92.842 964 61 6 1 960 191011295 191010336 0.000000e+00 1391
14 TraesCS7D01G005700 chr4B 96.130 646 23 2 1905 2549 191009265 191008621 0.000000e+00 1053
15 TraesCS7D01G005700 chr4B 95.020 502 25 0 2386 2887 541458441 541457940 0.000000e+00 789
16 TraesCS7D01G005700 chr6B 91.530 1039 60 10 2088 3122 409716094 409715080 0.000000e+00 1406
17 TraesCS7D01G005700 chr6B 92.599 581 23 11 1004 1580 505322447 505323011 0.000000e+00 817
18 TraesCS7D01G005700 chr6B 96.061 457 17 1 2473 2929 505324217 505324672 0.000000e+00 743
19 TraesCS7D01G005700 chr6B 92.401 329 24 1 1031 1359 549648294 549648621 4.710000e-128 468
20 TraesCS7D01G005700 chr6B 92.097 329 25 1 1031 1359 637592032 637591705 2.190000e-126 462
21 TraesCS7D01G005700 chr6B 95.266 169 8 0 1823 1991 59505470 59505302 5.130000e-68 268
22 TraesCS7D01G005700 chr5B 90.538 1004 76 7 1 988 20354070 20353070 0.000000e+00 1310
23 TraesCS7D01G005700 chr5B 93.313 329 22 0 1031 1359 26437467 26437795 1.300000e-133 486
24 TraesCS7D01G005700 chr1B 90.130 1003 77 9 1 987 338742502 338741506 0.000000e+00 1284
25 TraesCS7D01G005700 chr1B 88.780 1016 82 13 1 988 144367744 144366733 0.000000e+00 1216
26 TraesCS7D01G005700 chr2A 89.940 1004 84 9 1 988 777557172 777558174 0.000000e+00 1279
27 TraesCS7D01G005700 chr1D 89.822 953 80 14 10 953 308928768 308929712 0.000000e+00 1206
28 TraesCS7D01G005700 chr2B 96.744 645 21 0 1905 2549 737676712 737676068 0.000000e+00 1075
29 TraesCS7D01G005700 chr2B 92.661 327 22 1 1033 1359 61651376 61651700 1.310000e-128 470
30 TraesCS7D01G005700 chr2B 88.272 324 25 7 1265 1577 737677266 737676945 2.940000e-100 375
31 TraesCS7D01G005700 chr2B 93.277 119 8 0 2526 2644 677184500 677184618 3.200000e-40 176
32 TraesCS7D01G005700 chr4A 97.241 580 16 0 1970 2549 599535380 599534801 0.000000e+00 983
33 TraesCS7D01G005700 chr3B 91.630 454 32 4 2649 3096 785574589 785575042 9.510000e-175 623
34 TraesCS7D01G005700 chr3B 93.921 329 20 0 1031 1359 786704677 786705005 6.010000e-137 497
35 TraesCS7D01G005700 chr3B 91.437 327 22 4 2802 3122 335359528 335359202 7.940000e-121 444
36 TraesCS7D01G005700 chr6D 88.732 497 30 11 1199 1672 10697236 10697729 4.490000e-163 584
37 TraesCS7D01G005700 chr6D 92.424 132 8 1 1811 1942 10697891 10698020 1.480000e-43 187
38 TraesCS7D01G005700 chr6A 92.481 133 8 2 1811 1942 12284391 12284522 4.110000e-44 189


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G005700 chr7D 2748143 2751264 3121 True 5766.0 5766 100.0000 1 3122 1 chr7D.!!$R1 3121
1 TraesCS7D01G005700 chr7D 629748813 629750562 1749 True 2891.0 2891 96.4690 1021 2772 1 chr7D.!!$R2 1751
2 TraesCS7D01G005700 chr2D 53041606 53044736 3130 True 5014.0 5014 95.6360 1 3122 1 chr2D.!!$R1 3121
3 TraesCS7D01G005700 chr5D 249070078 249073170 3092 True 2397.5 3110 96.9015 7 3122 2 chr5D.!!$R2 3115
4 TraesCS7D01G005700 chr1A 9481145 9482486 1341 True 2191.0 2191 96.2770 1792 3122 1 chr1A.!!$R1 1330
5 TraesCS7D01G005700 chr1A 67963700 67964619 919 True 1175.0 1175 89.8160 10 926 1 chr1A.!!$R2 916
6 TraesCS7D01G005700 chr3A 480625636 480626872 1236 False 1676.0 1676 91.3110 7 1232 1 chr3A.!!$F1 1225
7 TraesCS7D01G005700 chr3A 548587940 548588452 512 False 789.0 789 94.5530 2613 3122 1 chr3A.!!$F2 509
8 TraesCS7D01G005700 chr3A 480634567 480635519 952 False 755.0 1277 95.6305 1506 2549 2 chr3A.!!$F3 1043
9 TraesCS7D01G005700 chr4B 201660807 201661839 1032 True 1622.0 1622 94.9950 2088 3122 1 chr4B.!!$R1 1034
10 TraesCS7D01G005700 chr4B 191008621 191011295 2674 True 1222.0 1391 94.4860 1 2549 2 chr4B.!!$R3 2548
11 TraesCS7D01G005700 chr4B 541457940 541458441 501 True 789.0 789 95.0200 2386 2887 1 chr4B.!!$R2 501
12 TraesCS7D01G005700 chr6B 409715080 409716094 1014 True 1406.0 1406 91.5300 2088 3122 1 chr6B.!!$R2 1034
13 TraesCS7D01G005700 chr6B 505322447 505324672 2225 False 780.0 817 94.3300 1004 2929 2 chr6B.!!$F2 1925
14 TraesCS7D01G005700 chr5B 20353070 20354070 1000 True 1310.0 1310 90.5380 1 988 1 chr5B.!!$R1 987
15 TraesCS7D01G005700 chr1B 338741506 338742502 996 True 1284.0 1284 90.1300 1 987 1 chr1B.!!$R2 986
16 TraesCS7D01G005700 chr1B 144366733 144367744 1011 True 1216.0 1216 88.7800 1 988 1 chr1B.!!$R1 987
17 TraesCS7D01G005700 chr2A 777557172 777558174 1002 False 1279.0 1279 89.9400 1 988 1 chr2A.!!$F1 987
18 TraesCS7D01G005700 chr1D 308928768 308929712 944 False 1206.0 1206 89.8220 10 953 1 chr1D.!!$F1 943
19 TraesCS7D01G005700 chr2B 737676068 737677266 1198 True 725.0 1075 92.5080 1265 2549 2 chr2B.!!$R1 1284
20 TraesCS7D01G005700 chr4A 599534801 599535380 579 True 983.0 983 97.2410 1970 2549 1 chr4A.!!$R1 579
21 TraesCS7D01G005700 chr6D 10697236 10698020 784 False 385.5 584 90.5780 1199 1942 2 chr6D.!!$F1 743

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
345 351 0.179111 CGCTTCCTACTGAATCGGCA 60.179 55.0 0.0 0.0 38.57 5.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2294 3433 1.37971 CGAATTCCCACCCATGCCA 60.38 57.895 0.0 0.0 0.0 4.92 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
121 122 6.760770 TCACATATAATGACACAATGCGAAGA 59.239 34.615 0.00 0.0 0.00 2.87
229 234 8.073467 AGTGGTTGAATCTTGGAAAACTTTTA 57.927 30.769 0.00 0.0 0.00 1.52
315 321 1.004044 ACTATGAGGCAGCTGCAGTTT 59.996 47.619 37.63 22.0 44.36 2.66
345 351 0.179111 CGCTTCCTACTGAATCGGCA 60.179 55.000 0.00 0.0 38.57 5.69
364 370 5.043248 CGGCAGAAATTTGTCTTTTTCACT 58.957 37.500 0.00 0.0 34.91 3.41
573 586 5.777223 TCCCCATATCAACATTGTTTGTCAA 59.223 36.000 0.00 0.0 37.68 3.18
788 821 4.740822 ATCCAACCCACCGCAGCC 62.741 66.667 0.00 0.0 0.00 4.85
869 918 1.462238 CCCCCGATCCAGATCCCTT 60.462 63.158 2.11 0.0 34.40 3.95
981 1297 5.634439 CACTCATCACAAGACAAGAGAAGAG 59.366 44.000 0.00 0.0 31.05 2.85
998 1314 0.973496 GAGGAAAGGACGGCTCTCCT 60.973 60.000 6.10 6.1 43.08 3.69
1119 1435 4.841617 TCCCTGCTCCGCCTCGAT 62.842 66.667 0.00 0.0 0.00 3.59
1189 1515 2.746277 GGAACATCGCCACGGCTT 60.746 61.111 6.48 0.0 39.32 4.35
1646 2117 2.593148 TGCACGGATTTGTGGCGT 60.593 55.556 0.00 0.0 40.26 5.68
1732 2203 2.674852 GTTCAATCGCTGCTTCATCTCA 59.325 45.455 0.00 0.0 0.00 3.27
2119 3258 3.637229 TCGTCTTCAAGAAGGACAAGACT 59.363 43.478 9.73 0.0 41.72 3.24
2176 3315 5.571658 GCTCCTCTTCTTCCTAACCATTTCA 60.572 44.000 0.00 0.0 0.00 2.69
2294 3433 9.778741 TGTAAGAAAGTGTCTAATCTGAAACAT 57.221 29.630 0.00 0.0 34.56 2.71
2602 3749 7.657761 GCCAGCAATACATATACTCTAGTTGTT 59.342 37.037 0.00 0.0 0.00 2.83
2677 3829 1.705450 CCTCCCCTCCCCTCCTCTA 60.705 68.421 0.00 0.0 0.00 2.43
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
315 321 4.020039 TCAGTAGGAAGCGGGTCAAATTTA 60.020 41.667 0.00 0.0 0.00 1.40
345 351 8.753497 ACCTCTAGTGAAAAAGACAAATTTCT 57.247 30.769 0.00 0.0 36.68 2.52
364 370 5.163141 TGTCAAAGGTTTTGATCCACCTCTA 60.163 40.000 8.42 0.0 43.05 2.43
573 586 3.312421 GTGCACTTGTGTGTATCTTGTGT 59.688 43.478 10.32 0.0 45.44 3.72
623 636 6.870965 GGCAAACATTCAACATATTAACCACA 59.129 34.615 0.00 0.0 0.00 4.17
788 821 1.226267 GCGCGTGTGAGAGAGAGAG 60.226 63.158 8.43 0.0 0.00 3.20
842 891 1.834822 GGATCGGGGGAGAGGAGTG 60.835 68.421 0.00 0.0 0.00 3.51
956 1030 3.657634 TCTCTTGTCTTGTGATGAGTGC 58.342 45.455 0.00 0.0 0.00 4.40
981 1297 1.219393 CAGGAGAGCCGTCCTTTCC 59.781 63.158 1.52 2.7 45.39 3.13
998 1314 1.422781 GGAGGATTGGATCTGGCATCA 59.577 52.381 0.00 0.0 0.00 3.07
1042 1358 3.803162 GAAGGGGAGGGGAGCAGC 61.803 72.222 0.00 0.0 0.00 5.25
1387 1725 2.126882 CAGAGAGAGAGAGGGAGAGGA 58.873 57.143 0.00 0.0 0.00 3.71
2032 3171 7.448469 AGGCACTAACTGAATACAAACAAGAAT 59.552 33.333 0.00 0.0 36.02 2.40
2119 3258 3.309296 GACTGATCCATTGGAGACCCTA 58.691 50.000 11.78 0.0 34.05 3.53
2176 3315 2.046892 GTGACGGCAGGCAGACAT 60.047 61.111 0.00 0.0 34.99 3.06
2294 3433 1.379710 CGAATTCCCACCCATGCCA 60.380 57.895 0.00 0.0 0.00 4.92
2602 3749 3.070476 TGGAACATCAAGCACAGCATA 57.930 42.857 0.00 0.0 0.00 3.14
2677 3829 9.199645 TCAGATCAGATCTAATCAAGAAGAAGT 57.800 33.333 12.88 0.0 37.58 3.01
2957 4109 8.367943 ACATCGTGTTAAACATTAGTACACAA 57.632 30.769 0.00 0.0 35.46 3.33


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.