Multiple sequence alignment - TraesCS7B01G490700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G490700 chr7B 100.000 4724 0 0 1 4724 743921067 743925790 0.000000e+00 8724.0
1 TraesCS7B01G490700 chr7B 99.896 1927 2 0 1 1927 743966342 743968268 0.000000e+00 3548.0
2 TraesCS7B01G490700 chr7B 99.480 1153 6 0 1957 3109 743968400 743969552 0.000000e+00 2097.0
3 TraesCS7B01G490700 chr7B 99.422 1038 5 1 3110 4147 743969902 743970938 0.000000e+00 1882.0
4 TraesCS7B01G490700 chr7B 98.966 580 6 0 4145 4724 743972050 743972629 0.000000e+00 1038.0
5 TraesCS7B01G490700 chr7B 84.842 442 65 2 4180 4620 743881332 743881772 1.210000e-120 444.0
6 TraesCS7B01G490700 chr7B 81.935 155 18 6 319 464 744075514 744075361 6.420000e-24 122.0
7 TraesCS7B01G490700 chr7B 86.813 91 12 0 4505 4595 743916791 743916881 8.360000e-18 102.0
8 TraesCS7B01G490700 chr7B 86.813 91 12 0 4505 4595 743962069 743962159 8.360000e-18 102.0
9 TraesCS7B01G490700 chr7B 86.207 58 7 1 1051 1107 20100689 20100632 1.420000e-05 62.1
10 TraesCS7B01G490700 chrUn 95.888 1143 45 1 1969 3109 88855032 88853890 0.000000e+00 1849.0
11 TraesCS7B01G490700 chrUn 95.713 1143 47 1 1969 3109 88835142 88834000 0.000000e+00 1838.0
12 TraesCS7B01G490700 chrUn 95.710 1049 32 6 3110 4150 88833651 88832608 0.000000e+00 1676.0
13 TraesCS7B01G490700 chrUn 95.710 1049 32 6 3110 4150 88853540 88852497 0.000000e+00 1676.0
14 TraesCS7B01G490700 chrUn 95.793 1046 31 6 3110 4147 363859216 363860256 0.000000e+00 1676.0
15 TraesCS7B01G490700 chrUn 96.724 580 17 2 4145 4724 88831499 88830922 0.000000e+00 965.0
16 TraesCS7B01G490700 chrUn 96.724 580 17 2 4145 4724 88851388 88850811 0.000000e+00 965.0
17 TraesCS7B01G490700 chrUn 90.794 554 51 0 1342 1895 88835788 88835235 0.000000e+00 741.0
18 TraesCS7B01G490700 chrUn 90.794 554 51 0 1342 1895 88855678 88855125 0.000000e+00 741.0
19 TraesCS7B01G490700 chr7A 87.428 1042 116 9 3110 4147 735519607 735520637 0.000000e+00 1184.0
20 TraesCS7B01G490700 chr7A 88.936 705 77 1 2376 3080 735518535 735519238 0.000000e+00 869.0
21 TraesCS7B01G490700 chr7A 90.000 390 39 0 1363 1752 735511016 735511405 5.460000e-139 505.0
22 TraesCS7B01G490700 chr7A 79.108 426 80 8 4173 4595 735505582 735506001 7.740000e-73 285.0
23 TraesCS7B01G490700 chr7A 89.143 175 18 1 690 864 622865088 622865261 2.860000e-52 217.0
24 TraesCS7B01G490700 chr7A 83.333 108 11 6 371 471 735647425 735647532 5.030000e-15 93.5
25 TraesCS7B01G490700 chr7A 92.982 57 4 0 4299 4355 735508551 735508607 3.030000e-12 84.2
26 TraesCS7B01G490700 chr7A 93.750 48 2 1 1219 1265 735510870 735510917 2.360000e-08 71.3
27 TraesCS7B01G490700 chr7A 87.273 55 6 1 1048 1101 79218183 79218237 1.420000e-05 62.1
28 TraesCS7B01G490700 chr5B 89.535 172 18 0 690 861 648261627 648261456 7.960000e-53 219.0
29 TraesCS7B01G490700 chr6B 89.143 175 18 1 690 864 551808690 551808517 2.860000e-52 217.0
30 TraesCS7B01G490700 chr6B 89.143 175 18 1 690 864 686371126 686371299 2.860000e-52 217.0
31 TraesCS7B01G490700 chr5A 89.143 175 18 1 690 864 660883382 660883209 2.860000e-52 217.0
32 TraesCS7B01G490700 chr4A 89.881 168 17 0 690 857 542123118 542123285 2.860000e-52 217.0
33 TraesCS7B01G490700 chr4A 89.143 175 18 1 690 864 614962795 614962968 2.860000e-52 217.0
34 TraesCS7B01G490700 chr2B 89.143 175 18 1 690 864 702713437 702713610 2.860000e-52 217.0
35 TraesCS7B01G490700 chr2A 97.297 37 1 0 1048 1084 79647735 79647771 3.950000e-06 63.9
36 TraesCS7B01G490700 chr6A 92.500 40 2 1 1052 1091 61895429 61895391 6.600000e-04 56.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G490700 chr7B 743921067 743925790 4723 False 8724.000 8724 100.00000 1 4724 1 chr7B.!!$F3 4723
1 TraesCS7B01G490700 chr7B 743966342 743972629 6287 False 2141.250 3548 99.44100 1 4724 4 chr7B.!!$F5 4723
2 TraesCS7B01G490700 chrUn 363859216 363860256 1040 False 1676.000 1676 95.79300 3110 4147 1 chrUn.!!$F1 1037
3 TraesCS7B01G490700 chrUn 88850811 88855678 4867 True 1307.750 1849 94.77900 1342 4724 4 chrUn.!!$R2 3382
4 TraesCS7B01G490700 chrUn 88830922 88835788 4866 True 1305.000 1838 94.73525 1342 4724 4 chrUn.!!$R1 3382
5 TraesCS7B01G490700 chr7A 735518535 735520637 2102 False 1026.500 1184 88.18200 2376 4147 2 chr7A.!!$F5 1771
6 TraesCS7B01G490700 chr7A 735505582 735511405 5823 False 236.375 505 88.96000 1219 4595 4 chr7A.!!$F4 3376

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
98 99 9.617523 AAACAAGAAAGAAAATCCAATCAACAT 57.382 25.926 0.0 0.0 0.0 2.71 F
1934 6078 0.481128 TCCCACAAGTTTTCCTCCCC 59.519 55.000 0.0 0.0 0.0 4.81 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1940 6084 3.508845 TTCTTGTCAAAAGAGAGGGGG 57.491 47.619 0.0 0.0 0.0 5.40 R
3976 8597 4.519540 ATGTGCAATTTTTAGCTCGGTT 57.480 36.364 0.0 0.0 0.0 4.44 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
98 99 9.617523 AAACAAGAAAGAAAATCCAATCAACAT 57.382 25.926 0.00 0.0 0.00 2.71
1927 6071 3.436243 TGTTCACCTTCCCACAAGTTTT 58.564 40.909 0.00 0.0 0.00 2.43
1931 6075 2.623416 CACCTTCCCACAAGTTTTCCTC 59.377 50.000 0.00 0.0 0.00 3.71
1932 6076 2.239400 CCTTCCCACAAGTTTTCCTCC 58.761 52.381 0.00 0.0 0.00 4.30
1933 6077 2.239400 CTTCCCACAAGTTTTCCTCCC 58.761 52.381 0.00 0.0 0.00 4.30
1934 6078 0.481128 TCCCACAAGTTTTCCTCCCC 59.519 55.000 0.00 0.0 0.00 4.81
2080 6328 7.360361 ACATATTGAAACGGAGAACTTGAAAC 58.640 34.615 0.00 0.0 0.00 2.78
2593 6841 1.318576 GGCGCAATACTAAGGGCATT 58.681 50.000 10.83 0.0 44.46 3.56
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
98 99 5.394224 TGTACATGAACGGACATTCTGTA 57.606 39.130 0.0 0.0 34.28 2.74
1940 6084 3.508845 TTCTTGTCAAAAGAGAGGGGG 57.491 47.619 0.0 0.0 0.00 5.40
1941 6085 6.410942 AAAATTCTTGTCAAAAGAGAGGGG 57.589 37.500 0.0 0.0 0.00 4.79
1942 6086 8.850156 TCTTAAAATTCTTGTCAAAAGAGAGGG 58.150 33.333 0.0 0.0 0.00 4.30
2080 6328 6.624352 TTCAAGAAGTCATTCTGTTTCTGG 57.376 37.500 0.0 0.0 45.25 3.86
3976 8597 4.519540 ATGTGCAATTTTTAGCTCGGTT 57.480 36.364 0.0 0.0 0.00 4.44
3977 8598 4.519540 AATGTGCAATTTTTAGCTCGGT 57.480 36.364 0.0 0.0 0.00 4.69
3979 8600 5.630680 AGTCAAATGTGCAATTTTTAGCTCG 59.369 36.000 0.0 0.0 0.00 5.03
3980 8601 6.617105 GCAGTCAAATGTGCAATTTTTAGCTC 60.617 38.462 0.0 0.0 39.62 4.09
3983 8604 6.643770 AGAGCAGTCAAATGTGCAATTTTTAG 59.356 34.615 0.0 0.0 42.47 1.85
4297 10040 9.283768 AGTTTGTTTGAATTTTCCTGACTTTTT 57.716 25.926 0.0 0.0 0.00 1.94
4457 10200 0.185901 TTTGTTGCTCTTGAGGGGCT 59.814 50.000 0.0 0.0 0.00 5.19
4458 10201 1.260544 ATTTGTTGCTCTTGAGGGGC 58.739 50.000 0.0 0.0 0.00 5.80


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.