Multiple sequence alignment - TraesCS7B01G488700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G488700 chr7B 100.000 2528 0 0 1 2528 743113318 743110791 0 4669
1 TraesCS7B01G488700 chr7B 98.983 1966 16 2 1 1965 743066309 743068271 0 3517
2 TraesCS7B01G488700 chr2A 98.830 1965 21 1 1 1965 735172803 735174765 0 3500
3 TraesCS7B01G488700 chr2A 97.906 573 11 1 1956 2528 735174880 735175451 0 990
4 TraesCS7B01G488700 chr5A 98.779 1966 20 3 2 1965 16623270 16621307 0 3494
5 TraesCS7B01G488700 chr5A 98.473 1965 27 2 1 1965 300048569 300050530 0 3459
6 TraesCS7B01G488700 chr7A 98.473 1965 28 2 1 1965 672005157 672007119 0 3461
7 TraesCS7B01G488700 chr7A 98.474 1966 24 3 1 1965 671960564 671958604 0 3459
8 TraesCS7B01G488700 chr7A 98.473 1965 23 3 1 1965 120828844 120826887 0 3456
9 TraesCS7B01G488700 chr7A 98.255 573 9 1 1956 2528 120923762 120923191 0 1002
10 TraesCS7B01G488700 chr7A 97.906 573 11 1 1956 2528 120826772 120826201 0 990
11 TraesCS7B01G488700 chr4D 98.423 1966 26 4 1 1965 123367646 123369607 0 3454
12 TraesCS7B01G488700 chr3B 98.422 1965 25 2 1 1965 201635799 201633841 0 3452
13 TraesCS7B01G488700 chr3B 97.906 573 10 2 1956 2528 201633726 201633156 0 990
14 TraesCS7B01G488700 chr5B 98.255 573 9 1 1956 2528 713044133 713043562 0 1002
15 TraesCS7B01G488700 chr7D 98.080 573 9 2 1956 2528 382012084 382011514 0 996
16 TraesCS7B01G488700 chr2D 98.080 573 10 1 1956 2528 17965108 17964537 0 996
17 TraesCS7B01G488700 chr2D 97.731 573 11 2 1956 2528 635039339 635039909 0 985
18 TraesCS7B01G488700 chr3D 97.906 573 11 1 1956 2528 202614025 202614596 0 990


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G488700 chr7B 743110791 743113318 2527 True 4669 4669 100.0000 1 2528 1 chr7B.!!$R1 2527
1 TraesCS7B01G488700 chr7B 743066309 743068271 1962 False 3517 3517 98.9830 1 1965 1 chr7B.!!$F1 1964
2 TraesCS7B01G488700 chr2A 735172803 735175451 2648 False 2245 3500 98.3680 1 2528 2 chr2A.!!$F1 2527
3 TraesCS7B01G488700 chr5A 16621307 16623270 1963 True 3494 3494 98.7790 2 1965 1 chr5A.!!$R1 1963
4 TraesCS7B01G488700 chr5A 300048569 300050530 1961 False 3459 3459 98.4730 1 1965 1 chr5A.!!$F1 1964
5 TraesCS7B01G488700 chr7A 672005157 672007119 1962 False 3461 3461 98.4730 1 1965 1 chr7A.!!$F1 1964
6 TraesCS7B01G488700 chr7A 671958604 671960564 1960 True 3459 3459 98.4740 1 1965 1 chr7A.!!$R2 1964
7 TraesCS7B01G488700 chr7A 120826201 120828844 2643 True 2223 3456 98.1895 1 2528 2 chr7A.!!$R3 2527
8 TraesCS7B01G488700 chr7A 120923191 120923762 571 True 1002 1002 98.2550 1956 2528 1 chr7A.!!$R1 572
9 TraesCS7B01G488700 chr4D 123367646 123369607 1961 False 3454 3454 98.4230 1 1965 1 chr4D.!!$F1 1964
10 TraesCS7B01G488700 chr3B 201633156 201635799 2643 True 2221 3452 98.1640 1 2528 2 chr3B.!!$R1 2527
11 TraesCS7B01G488700 chr5B 713043562 713044133 571 True 1002 1002 98.2550 1956 2528 1 chr5B.!!$R1 572
12 TraesCS7B01G488700 chr7D 382011514 382012084 570 True 996 996 98.0800 1956 2528 1 chr7D.!!$R1 572
13 TraesCS7B01G488700 chr2D 17964537 17965108 571 True 996 996 98.0800 1956 2528 1 chr2D.!!$R1 572
14 TraesCS7B01G488700 chr2D 635039339 635039909 570 False 985 985 97.7310 1956 2528 1 chr2D.!!$F1 572
15 TraesCS7B01G488700 chr3D 202614025 202614596 571 False 990 990 97.9060 1956 2528 1 chr3D.!!$F1 572

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
549 551 0.317799 TTTGGCCGCTACTACGTTCA 59.682 50.0 0.0 0.0 0.0 3.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2003 2135 0.179015 CTCTGCCGAGCTCTACCCTA 60.179 60.0 12.85 0.0 0.0 3.53 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
32 33 4.517832 CCCTTGGAGCTTTACGTTAAACTT 59.482 41.667 0.0 0.0 0.00 2.66
263 265 4.923871 GTCATCGTCTTCTTTAGAGTTGCA 59.076 41.667 0.0 0.0 32.23 4.08
334 336 7.240616 ACAGGCTTATCTATTTTATGGGGAGAT 59.759 37.037 0.0 0.0 0.00 2.75
549 551 0.317799 TTTGGCCGCTACTACGTTCA 59.682 50.000 0.0 0.0 0.00 3.18
819 821 3.370953 CCCCACTACTTCTTCATTCAGGG 60.371 52.174 0.0 0.0 0.00 4.45
820 822 3.370953 CCCACTACTTCTTCATTCAGGGG 60.371 52.174 0.0 0.0 0.00 4.79
821 823 3.370953 CCACTACTTCTTCATTCAGGGGG 60.371 52.174 0.0 0.0 0.00 5.40
894 899 5.163550 CCACCTACTCACTCATCAATTACGA 60.164 44.000 0.0 0.0 0.00 3.43
1574 1579 5.954150 TCGTCATAAAGTAGTAAAGGTCCCT 59.046 40.000 0.0 0.0 0.00 4.20
2001 2133 2.383855 CCCCCTTCCAAATAAATGCGA 58.616 47.619 0.0 0.0 0.00 5.10
2003 2135 3.023832 CCCCTTCCAAATAAATGCGAGT 58.976 45.455 0.0 0.0 0.00 4.18
2154 2286 0.108992 CAAGCAGCATTGTTCGCCAT 60.109 50.000 0.0 0.0 0.00 4.40
2243 2375 3.744719 CGACGGAAGCTCGGGACA 61.745 66.667 0.0 0.0 33.27 4.02
2324 2456 1.272769 GAGCTTCGACCAACTACCACT 59.727 52.381 0.0 0.0 0.00 4.00
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
32 33 1.677633 TGAGCCATCAGTCGGACGA 60.678 57.895 1.89 3.97 0.00 4.20
90 91 5.420409 AGAGATCGTCAGATAAACCAAACC 58.580 41.667 0.00 0.00 37.19 3.27
143 144 2.761213 GGGGCAGCCATGAAAGGG 60.761 66.667 15.19 0.00 43.76 3.95
263 265 2.615447 CAATCGGCATCAGTAGTTGCAT 59.385 45.455 0.00 0.00 41.24 3.96
334 336 8.539117 TTTATCTCATCCAAGATAGTGTCTCA 57.461 34.615 0.00 0.00 38.97 3.27
549 551 3.191371 GGTGCCATCAAGAAGTTTTCGAT 59.809 43.478 0.00 0.00 34.02 3.59
894 899 1.878088 CTGTGCAAGTCAGCTGAACAT 59.122 47.619 20.19 4.60 34.99 2.71
2001 2133 0.466555 CTGCCGAGCTCTACCCTACT 60.467 60.000 12.85 0.00 0.00 2.57
2003 2135 0.179015 CTCTGCCGAGCTCTACCCTA 60.179 60.000 12.85 0.00 0.00 3.53
2154 2286 2.859165 ATCTTTTGCTTCTCGGGTGA 57.141 45.000 0.00 0.00 0.00 4.02
2324 2456 0.897863 CCCCAAAGCGGAATTGACCA 60.898 55.000 0.00 0.00 36.56 4.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.