Multiple sequence alignment - TraesCS7B01G488500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G488500 chr7B 100.000 2723 0 0 1 2723 743087695 743090417 0 5029
1 TraesCS7B01G488500 chr5B 99.449 2723 15 0 1 2723 679660393 679663115 0 4946
2 TraesCS7B01G488500 chrUn 99.339 2725 16 2 1 2723 189394035 189396759 0 4931
3 TraesCS7B01G488500 chr5A 99.302 2723 19 0 1 2723 16601427 16598705 0 4924
4 TraesCS7B01G488500 chr5A 99.229 2724 20 1 1 2723 300074475 300077198 0 4913
5 TraesCS7B01G488500 chr6A 99.266 2723 20 0 1 2723 289130126 289132848 0 4918
6 TraesCS7B01G488500 chr7D 99.156 2724 21 2 2 2723 203554849 203552126 0 4902
7 TraesCS7B01G488500 chr2A 99.082 2723 23 2 1 2723 735194150 735196870 0 4889
8 TraesCS7B01G488500 chr3B 98.935 2723 28 1 1 2723 92201097 92203818 0 4867
9 TraesCS7B01G488500 chr3B 96.109 2724 101 5 1 2723 368726797 368729516 0 4438


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G488500 chr7B 743087695 743090417 2722 False 5029 5029 100.000 1 2723 1 chr7B.!!$F1 2722
1 TraesCS7B01G488500 chr5B 679660393 679663115 2722 False 4946 4946 99.449 1 2723 1 chr5B.!!$F1 2722
2 TraesCS7B01G488500 chrUn 189394035 189396759 2724 False 4931 4931 99.339 1 2723 1 chrUn.!!$F1 2722
3 TraesCS7B01G488500 chr5A 16598705 16601427 2722 True 4924 4924 99.302 1 2723 1 chr5A.!!$R1 2722
4 TraesCS7B01G488500 chr5A 300074475 300077198 2723 False 4913 4913 99.229 1 2723 1 chr5A.!!$F1 2722
5 TraesCS7B01G488500 chr6A 289130126 289132848 2722 False 4918 4918 99.266 1 2723 1 chr6A.!!$F1 2722
6 TraesCS7B01G488500 chr7D 203552126 203554849 2723 True 4902 4902 99.156 2 2723 1 chr7D.!!$R1 2721
7 TraesCS7B01G488500 chr2A 735194150 735196870 2720 False 4889 4889 99.082 1 2723 1 chr2A.!!$F1 2722
8 TraesCS7B01G488500 chr3B 92201097 92203818 2721 False 4867 4867 98.935 1 2723 1 chr3B.!!$F1 2722
9 TraesCS7B01G488500 chr3B 368726797 368729516 2719 False 4438 4438 96.109 1 2723 1 chr3B.!!$F2 2722

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
579 580 1.376553 GCCGAGAAGCTTCTTGCCT 60.377 57.895 30.99 11.2 44.23 4.75 F
1011 1012 7.440856 GGCAAGGAAAATAAAATGTCAGTTTCA 59.559 33.333 0.75 0.0 0.00 2.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1529 1533 0.394565 AGATCGGCTAATGCTCCCAC 59.605 55.000 0.0 0.0 39.59 4.61 R
2126 2131 1.473434 CCCTGTGATACGCCTTCCTTC 60.473 57.143 0.0 0.0 0.00 3.46 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
286 287 6.025749 TCGATGGCGATGTAAGATAGAAAT 57.974 37.500 0.00 0.0 42.51 2.17
316 317 2.498885 GTTAGGGCTTCGGTTTCCTCTA 59.501 50.000 0.00 0.0 0.00 2.43
369 370 3.258372 ACATGCGGACTCACTTCTCTTTA 59.742 43.478 0.00 0.0 0.00 1.85
579 580 1.376553 GCCGAGAAGCTTCTTGCCT 60.377 57.895 30.99 11.2 44.23 4.75
1011 1012 7.440856 GGCAAGGAAAATAAAATGTCAGTTTCA 59.559 33.333 0.75 0.0 0.00 2.69
1529 1533 2.032894 GGTGGAATACATCGCATCAACG 60.033 50.000 0.00 0.0 0.00 4.10
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
286 287 1.766496 CGAAGCCCTAACTCCCCATTA 59.234 52.381 0.0 0.0 0.00 1.90
316 317 6.855763 TGATTTGGAATTGAAACTGGCTAT 57.144 33.333 0.0 0.0 0.00 2.97
369 370 9.492730 AACTTGGATAATAAAAGTCATCCCATT 57.507 29.630 0.0 0.0 36.85 3.16
579 580 1.828768 CTTTGCTTTTGGGGGCACA 59.171 52.632 0.0 0.0 38.23 4.57
1529 1533 0.394565 AGATCGGCTAATGCTCCCAC 59.605 55.000 0.0 0.0 39.59 4.61
2126 2131 1.473434 CCCTGTGATACGCCTTCCTTC 60.473 57.143 0.0 0.0 0.00 3.46


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.