Multiple sequence alignment - TraesCS7B01G488400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G488400 chr7B 100.000 2319 0 0 1 2319 743086200 743088518 0 4283
1 TraesCS7B01G488400 chr5A 99.353 2320 13 2 1 2319 300072980 300075298 0 4200
2 TraesCS7B01G488400 chr5A 98.965 2319 20 3 1 2319 16602918 16600604 0 4146
3 TraesCS7B01G488400 chr2A 99.267 2320 15 2 1 2319 618279955 618277637 0 4189
4 TraesCS7B01G488400 chrUn 99.138 2320 18 2 1 2319 189392540 189394858 0 4172
5 TraesCS7B01G488400 chr6A 99.094 2319 19 2 1 2319 289128633 289130949 0 4165
6 TraesCS7B01G488400 chr7D 98.966 2320 22 2 1 2319 626698489 626696171 0 4150
7 TraesCS7B01G488400 chr7D 98.836 2319 26 1 1 2319 203556344 203554027 0 4132
8 TraesCS7B01G488400 chr3B 98.836 2319 24 3 1 2319 92199605 92201920 0 4130
9 TraesCS7B01G488400 chr7A 98.752 2324 23 2 1 2319 4959839 4962161 0 4126


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G488400 chr7B 743086200 743088518 2318 False 4283 4283 100.000 1 2319 1 chr7B.!!$F1 2318
1 TraesCS7B01G488400 chr5A 300072980 300075298 2318 False 4200 4200 99.353 1 2319 1 chr5A.!!$F1 2318
2 TraesCS7B01G488400 chr5A 16600604 16602918 2314 True 4146 4146 98.965 1 2319 1 chr5A.!!$R1 2318
3 TraesCS7B01G488400 chr2A 618277637 618279955 2318 True 4189 4189 99.267 1 2319 1 chr2A.!!$R1 2318
4 TraesCS7B01G488400 chrUn 189392540 189394858 2318 False 4172 4172 99.138 1 2319 1 chrUn.!!$F1 2318
5 TraesCS7B01G488400 chr6A 289128633 289130949 2316 False 4165 4165 99.094 1 2319 1 chr6A.!!$F1 2318
6 TraesCS7B01G488400 chr7D 626696171 626698489 2318 True 4150 4150 98.966 1 2319 1 chr7D.!!$R2 2318
7 TraesCS7B01G488400 chr7D 203554027 203556344 2317 True 4132 4132 98.836 1 2319 1 chr7D.!!$R1 2318
8 TraesCS7B01G488400 chr3B 92199605 92201920 2315 False 4130 4130 98.836 1 2319 1 chr3B.!!$F1 2318
9 TraesCS7B01G488400 chr7A 4959839 4962161 2322 False 4126 4126 98.752 1 2319 1 chr7A.!!$F1 2318

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
663 666 2.568956 AGACAGCAGCAAGTTCCTATCA 59.431 45.455 0.0 0.0 0.0 2.15 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1781 1792 1.766496 CGAAGCCCTAACTCCCCATTA 59.234 52.381 0.0 0.0 0.0 1.9 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
41 42 3.568430 AGGGGTTTGATTCGTTCTTTGAC 59.432 43.478 0.00 0.00 0.00 3.18
499 502 3.932710 CGAAAGAGGATGAAACGGATCAA 59.067 43.478 0.00 0.00 32.06 2.57
663 666 2.568956 AGACAGCAGCAAGTTCCTATCA 59.431 45.455 0.00 0.00 0.00 2.15
904 907 3.380479 TCGGACTCGACTCACATTTTT 57.620 42.857 0.00 0.00 40.88 1.94
1241 1246 4.016113 TGTGATCTATTCTCGTGTCACG 57.984 45.455 19.38 19.38 44.19 4.35
1442 1448 1.270625 CCAAGCCAAACACGTCTCCTA 60.271 52.381 0.00 0.00 0.00 2.94
1781 1792 6.025749 TCGATGGCGATGTAAGATAGAAAT 57.974 37.500 0.00 0.00 42.51 2.17
1811 1822 2.498885 GTTAGGGCTTCGGTTTCCTCTA 59.501 50.000 0.00 0.00 0.00 2.43
1864 1875 3.258372 ACATGCGGACTCACTTCTCTTTA 59.742 43.478 0.00 0.00 0.00 1.85
2074 2085 1.376553 GCCGAGAAGCTTCTTGCCT 60.377 57.895 30.99 11.20 44.23 4.75
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
41 42 6.373186 GGTATTCCGACCTTATCTTTTTGG 57.627 41.667 0.0 0.0 36.47 3.28
499 502 4.196971 GGGTAATGCTAAGTTGAATCGGT 58.803 43.478 0.0 0.0 0.00 4.69
663 666 7.276658 GTCATATTGATCTGTCGTCTTGTTCTT 59.723 37.037 0.0 0.0 0.00 2.52
904 907 2.233676 TGAAAGCAAGCGTAGGAGATCA 59.766 45.455 0.0 0.0 0.00 2.92
1241 1246 2.997303 GAGGGAGAAGAAAGAAAGCGAC 59.003 50.000 0.0 0.0 0.00 5.19
1442 1448 0.038159 CGCGAGAAGACCCTTGACTT 60.038 55.000 0.0 0.0 0.00 3.01
1781 1792 1.766496 CGAAGCCCTAACTCCCCATTA 59.234 52.381 0.0 0.0 0.00 1.90
1811 1822 6.855763 TGATTTGGAATTGAAACTGGCTAT 57.144 33.333 0.0 0.0 0.00 2.97
1864 1875 9.492730 AACTTGGATAATAAAAGTCATCCCATT 57.507 29.630 0.0 0.0 36.85 3.16
2074 2085 1.828768 CTTTGCTTTTGGGGGCACA 59.171 52.632 0.0 0.0 38.23 4.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.