Multiple sequence alignment - TraesCS7B01G488300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G488300 chr7B 100.000 2528 0 0 1 2528 743066306 743068833 0 4669
1 TraesCS7B01G488300 chr5A 99.091 2530 21 2 1 2528 16623274 16620745 0 4543
2 TraesCS7B01G488300 chr5A 98.773 2527 28 2 1 2526 300048566 300051090 0 4492
3 TraesCS7B01G488300 chr2A 99.129 2527 20 2 1 2526 735172800 735175325 0 4543
4 TraesCS7B01G488300 chr7A 98.972 2528 24 2 1 2528 671960567 671958042 0 4523
5 TraesCS7B01G488300 chr7A 98.892 2528 23 3 1 2528 120828847 120826325 0 4508
6 TraesCS7B01G488300 chr7A 98.616 2528 33 2 1 2528 120925840 120923315 0 4473
7 TraesCS7B01G488300 chr3B 98.853 2528 24 4 1 2528 201635802 201633280 0 4503
8 TraesCS7B01G488300 chr2D 98.774 2529 27 3 1 2528 635037261 635039786 0 4495
9 TraesCS7B01G488300 chr5B 98.773 2526 28 2 3 2528 713046208 713043686 0 4490


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G488300 chr7B 743066306 743068833 2527 False 4669 4669 100.000 1 2528 1 chr7B.!!$F1 2527
1 TraesCS7B01G488300 chr5A 16620745 16623274 2529 True 4543 4543 99.091 1 2528 1 chr5A.!!$R1 2527
2 TraesCS7B01G488300 chr5A 300048566 300051090 2524 False 4492 4492 98.773 1 2526 1 chr5A.!!$F1 2525
3 TraesCS7B01G488300 chr2A 735172800 735175325 2525 False 4543 4543 99.129 1 2526 1 chr2A.!!$F1 2525
4 TraesCS7B01G488300 chr7A 671958042 671960567 2525 True 4523 4523 98.972 1 2528 1 chr7A.!!$R3 2527
5 TraesCS7B01G488300 chr7A 120826325 120828847 2522 True 4508 4508 98.892 1 2528 1 chr7A.!!$R1 2527
6 TraesCS7B01G488300 chr7A 120923315 120925840 2525 True 4473 4473 98.616 1 2528 1 chr7A.!!$R2 2527
7 TraesCS7B01G488300 chr3B 201633280 201635802 2522 True 4503 4503 98.853 1 2528 1 chr3B.!!$R1 2527
8 TraesCS7B01G488300 chr2D 635037261 635039786 2525 False 4495 4495 98.774 1 2528 1 chr2D.!!$F1 2527
9 TraesCS7B01G488300 chr5B 713043686 713046208 2522 True 4490 4490 98.773 3 2528 1 chr5B.!!$R1 2525

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
691 693 4.922206 AGGTGCACCTTAGATTGAAATCA 58.078 39.13 33.2 0.0 46.09 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2127 2136 1.452145 CTCTGCCGAGCTCTACCCTC 61.452 65.0 12.85 0.0 0.0 4.3 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
691 693 4.922206 AGGTGCACCTTAGATTGAAATCA 58.078 39.130 33.20 0.0 46.09 2.57
1727 1734 5.279056 GCCTACTCAGGTCTTGTATGGATAC 60.279 48.000 0.00 0.0 44.68 2.24
2127 2136 1.412343 CCCTTCCAAATAAATGCGGGG 59.588 52.381 0.00 0.0 0.00 5.73
2454 2463 0.320160 GACCAACTACCACCGGTCAC 60.320 60.000 2.59 0.0 45.96 3.67
2503 2512 7.063801 TCTACCATCATTATAGGGGTATGGA 57.936 40.000 6.18 0.0 37.80 3.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
691 693 4.511082 CCATCTGGCAAAACGAAATTTGTT 59.489 37.500 0.00 0.00 41.34 2.83
1378 1385 4.518217 GACACGGCGATCATTAGAAATTG 58.482 43.478 16.62 0.00 0.00 2.32
1727 1734 4.785453 GGAGCACCCCTTCCTGCG 62.785 72.222 0.00 0.00 38.51 5.18
1818 1825 2.162754 CGTTACCCGAATTCGCGCT 61.163 57.895 22.36 8.64 39.56 5.92
2127 2136 1.452145 CTCTGCCGAGCTCTACCCTC 61.452 65.000 12.85 0.00 0.00 4.30
2454 2463 3.373565 GTGGCCCCAAAGCGGAAG 61.374 66.667 0.00 0.00 36.56 3.46
2503 2512 5.698545 CCTTGATCTTTCTTTGTCTCGAACT 59.301 40.000 0.00 0.00 0.00 3.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.