Multiple sequence alignment - TraesCS7B01G488200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G488200 chr7B 100.000 2408 0 0 1 2408 743033700 743036107 0 4447
1 TraesCS7B01G488200 chrUn 99.211 2408 15 3 1 2408 45100792 45098389 0 4338
2 TraesCS7B01G488200 chrUn 99.087 2409 18 3 1 2408 261513064 261515469 0 4324
3 TraesCS7B01G488200 chr5B 99.128 2408 18 2 1 2408 130614901 130612497 0 4327
4 TraesCS7B01G488200 chr5B 99.086 2408 18 3 1 2408 130609877 130607474 0 4322
5 TraesCS7B01G488200 chr3A 99.128 2408 18 2 1 2408 66030313 66032717 0 4327
6 TraesCS7B01G488200 chr5A 98.258 2411 36 3 1 2408 238861455 238859048 0 4215
7 TraesCS7B01G488200 chr5A 98.050 2410 39 4 1 2408 238828027 238830430 0 4183


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G488200 chr7B 743033700 743036107 2407 False 4447.0 4447 100.000 1 2408 1 chr7B.!!$F1 2407
1 TraesCS7B01G488200 chrUn 45098389 45100792 2403 True 4338.0 4338 99.211 1 2408 1 chrUn.!!$R1 2407
2 TraesCS7B01G488200 chrUn 261513064 261515469 2405 False 4324.0 4324 99.087 1 2408 1 chrUn.!!$F1 2407
3 TraesCS7B01G488200 chr5B 130607474 130614901 7427 True 4324.5 4327 99.107 1 2408 2 chr5B.!!$R1 2407
4 TraesCS7B01G488200 chr3A 66030313 66032717 2404 False 4327.0 4327 99.128 1 2408 1 chr3A.!!$F1 2407
5 TraesCS7B01G488200 chr5A 238859048 238861455 2407 True 4215.0 4215 98.258 1 2408 1 chr5A.!!$R1 2407
6 TraesCS7B01G488200 chr5A 238828027 238830430 2403 False 4183.0 4183 98.050 1 2408 1 chr5A.!!$F1 2407

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
97 98 0.61782 AGGAGTCGGTAGTTGGGCAT 60.618 55.0 0.0 0.0 0.0 4.4 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1592 1597 1.474077 CACAAGGAACCTTAGCATGGC 59.526 52.381 5.75 0.0 34.5 4.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
41 42 2.291209 TGGTAGGTGTCCACTAACGA 57.709 50.000 0.00 0.00 30.72 3.85
97 98 0.617820 AGGAGTCGGTAGTTGGGCAT 60.618 55.000 0.00 0.00 0.00 4.40
269 270 2.811431 CCAATCTTCACTTTACGCCACA 59.189 45.455 0.00 0.00 0.00 4.17
502 503 4.035792 CGCACCCGAACAATAATATTCCAA 59.964 41.667 0.00 0.00 36.29 3.53
673 674 2.733517 GCATACTGCGAGTAGGAAGTC 58.266 52.381 10.72 0.00 34.67 3.01
1592 1597 2.277084 CAAAAGGATTAGGACGTCCCG 58.723 52.381 30.82 3.19 40.87 5.14
1608 1613 1.224592 CCGCCATGCTAAGGTTCCT 59.775 57.895 0.00 0.00 0.00 3.36
1611 1616 1.839424 GCCATGCTAAGGTTCCTTGT 58.161 50.000 13.64 0.00 0.00 3.16
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
15 16 2.536761 TGGACACCTACCACTTTTCG 57.463 50.000 0.00 0.00 32.03 3.46
41 42 1.403687 GGAGCCGAGCCAGGAATAGT 61.404 60.000 0.00 0.00 0.00 2.12
502 503 4.591321 TGATCTTAGGTGCATTTCCCTT 57.409 40.909 0.00 0.00 32.08 3.95
673 674 9.720667 TGCTTCTGAATTCATTGTATTAATTCG 57.279 29.630 8.96 0.00 40.76 3.34
726 727 4.320935 GCTGGTACCATTTCGATGTGTTTT 60.321 41.667 16.75 0.00 0.00 2.43
1592 1597 1.474077 CACAAGGAACCTTAGCATGGC 59.526 52.381 5.75 0.00 34.50 4.40
1608 1613 3.255423 TAATGCGGCCGGACCACAA 62.255 57.895 29.38 5.66 39.03 3.33
1611 1616 4.169696 CCTAATGCGGCCGGACCA 62.170 66.667 29.38 17.40 39.03 4.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.