Multiple sequence alignment - TraesCS7B01G488100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G488100 chr7B 100.000 2414 0 0 1 2414 743004895 743007308 0 4458
1 TraesCS7B01G488100 chr7B 96.272 2414 85 2 1 2414 247459881 247462289 0 3954
2 TraesCS7B01G488100 chrUn 99.171 2414 19 1 1 2414 221549585 221547173 0 4346
3 TraesCS7B01G488100 chrUn 99.006 2414 23 1 1 2414 186192583 186190171 0 4324
4 TraesCS7B01G488100 chr7A 98.177 2414 33 2 1 2414 120879289 120881691 0 4204
5 TraesCS7B01G488100 chr3A 97.683 2417 50 4 1 2414 51914991 51917404 0 4148
6 TraesCS7B01G488100 chr6D 98.601 2287 29 3 1 2286 458963782 458966066 0 4043
7 TraesCS7B01G488100 chr6A 96.729 2415 73 5 1 2414 79142510 79144919 0 4017
8 TraesCS7B01G488100 chr1B 95.983 2415 88 5 1 2414 499826022 499828428 0 3914
9 TraesCS7B01G488100 chr2B 94.449 2414 127 5 1 2414 343521094 343523500 0 3709


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G488100 chr7B 743004895 743007308 2413 False 4458 4458 100.000 1 2414 1 chr7B.!!$F2 2413
1 TraesCS7B01G488100 chr7B 247459881 247462289 2408 False 3954 3954 96.272 1 2414 1 chr7B.!!$F1 2413
2 TraesCS7B01G488100 chrUn 221547173 221549585 2412 True 4346 4346 99.171 1 2414 1 chrUn.!!$R2 2413
3 TraesCS7B01G488100 chrUn 186190171 186192583 2412 True 4324 4324 99.006 1 2414 1 chrUn.!!$R1 2413
4 TraesCS7B01G488100 chr7A 120879289 120881691 2402 False 4204 4204 98.177 1 2414 1 chr7A.!!$F1 2413
5 TraesCS7B01G488100 chr3A 51914991 51917404 2413 False 4148 4148 97.683 1 2414 1 chr3A.!!$F1 2413
6 TraesCS7B01G488100 chr6D 458963782 458966066 2284 False 4043 4043 98.601 1 2286 1 chr6D.!!$F1 2285
7 TraesCS7B01G488100 chr6A 79142510 79144919 2409 False 4017 4017 96.729 1 2414 1 chr6A.!!$F1 2413
8 TraesCS7B01G488100 chr1B 499826022 499828428 2406 False 3914 3914 95.983 1 2414 1 chr1B.!!$F1 2413
9 TraesCS7B01G488100 chr2B 343521094 343523500 2406 False 3709 3709 94.449 1 2414 1 chr2B.!!$F1 2413

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
680 682 0.89832 TGGCTCTTCTCCACTAGCAC 59.102 55.0 0.0 0.0 36.68 4.4 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2153 2166 8.814235 AGTTTCGATCGGTTAATAACATTGTAG 58.186 33.333 16.41 0.0 0.0 2.74 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
37 38 6.560253 TTTCTAGTTGCTGTGGAAAGAATC 57.440 37.500 0.00 0.00 0.00 2.52
180 181 7.754924 ACATTTTATTGCTTACGTGAGGAAATG 59.245 33.333 17.73 17.23 37.02 2.32
434 436 3.565905 AAAGCTTCTCAAAAGCATCCG 57.434 42.857 11.90 0.00 45.30 4.18
474 476 1.141881 CGAGATCACCTTCACGGGG 59.858 63.158 0.00 0.00 37.63 5.73
550 552 6.372381 TCCCGAAACTTGGTTTAGTATTAAGC 59.628 38.462 0.00 0.00 35.77 3.09
680 682 0.898320 TGGCTCTTCTCCACTAGCAC 59.102 55.000 0.00 0.00 36.68 4.40
1393 1399 6.041751 GTCGGAGGATCTTAGAAGGGAATTAA 59.958 42.308 0.00 0.00 33.73 1.40
1394 1400 6.614087 TCGGAGGATCTTAGAAGGGAATTAAA 59.386 38.462 0.00 0.00 33.73 1.52
1516 1527 9.912634 CTCTTTGATAAGGAAAGTTTGCATTTA 57.087 29.630 9.95 1.01 33.04 1.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
37 38 4.524328 ACCCCTTAAACTCATTTGCTCAAG 59.476 41.667 0.00 0.0 0.00 3.02
180 181 8.742554 AATACAAATTCGAGTTCCAAATTGAC 57.257 30.769 0.00 0.0 0.00 3.18
434 436 8.253810 TCTCGATCACCATTCTATGATATTTCC 58.746 37.037 0.00 0.0 35.67 3.13
474 476 3.432608 CCCCCAATTTGCAAAGGATGATC 60.433 47.826 18.19 0.0 0.00 2.92
550 552 4.561105 ACTAAACGCTGGAAGAGAAGAAG 58.439 43.478 0.00 0.0 37.13 2.85
680 682 5.689819 AGTGCAAATAGAAAGCAGTAAACG 58.310 37.500 0.00 0.0 39.93 3.60
2153 2166 8.814235 AGTTTCGATCGGTTAATAACATTGTAG 58.186 33.333 16.41 0.0 0.00 2.74


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.