Multiple sequence alignment - TraesCS7B01G488000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G488000 chr7B 100.000 2646 0 0 1 2646 742996151 742993506 0 4887
1 TraesCS7B01G488000 chr7B 98.904 2646 28 1 1 2646 716872076 716874720 0 4724
2 TraesCS7B01G488000 chr1A 99.093 2646 21 2 1 2646 498684525 498687167 0 4750
3 TraesCS7B01G488000 chrUn 99.092 2643 24 0 1 2643 186201715 186204357 0 4748
4 TraesCS7B01G488000 chr5A 98.791 2646 32 0 1 2646 492862433 492859788 0 4710
5 TraesCS7B01G488000 chr2B 98.413 2646 42 0 1 2646 391167714 391165069 0 4654
6 TraesCS7B01G488000 chr2B 98.413 2646 39 2 1 2646 112847905 112845263 0 4650
7 TraesCS7B01G488000 chr4A 98.376 2647 41 2 1 2646 67603672 67601027 0 4649


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G488000 chr7B 742993506 742996151 2645 True 4887 4887 100.000 1 2646 1 chr7B.!!$R1 2645
1 TraesCS7B01G488000 chr7B 716872076 716874720 2644 False 4724 4724 98.904 1 2646 1 chr7B.!!$F1 2645
2 TraesCS7B01G488000 chr1A 498684525 498687167 2642 False 4750 4750 99.093 1 2646 1 chr1A.!!$F1 2645
3 TraesCS7B01G488000 chrUn 186201715 186204357 2642 False 4748 4748 99.092 1 2643 1 chrUn.!!$F1 2642
4 TraesCS7B01G488000 chr5A 492859788 492862433 2645 True 4710 4710 98.791 1 2646 1 chr5A.!!$R1 2645
5 TraesCS7B01G488000 chr2B 391165069 391167714 2645 True 4654 4654 98.413 1 2646 1 chr2B.!!$R2 2645
6 TraesCS7B01G488000 chr2B 112845263 112847905 2642 True 4650 4650 98.413 1 2646 1 chr2B.!!$R1 2645
7 TraesCS7B01G488000 chr4A 67601027 67603672 2645 True 4649 4649 98.376 1 2646 1 chr4A.!!$R1 2645

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
222 224 3.078837 GTCCGGCCATTTTAGTTTCAGA 58.921 45.455 2.24 0.0 0.0 3.27 F
883 886 6.290294 AGAGCAAAGCAATTCCAACATAAT 57.710 33.333 0.00 0.0 0.0 1.28 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1140 1144 7.398024 AGTGAGCCTATTACATCAAGTTCTTT 58.602 34.615 0.0 0.0 0.00 2.52 R
2565 2570 0.180171 TTCATGCCACTATGGGGTCG 59.820 55.000 0.0 0.0 38.19 4.79 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
222 224 3.078837 GTCCGGCCATTTTAGTTTCAGA 58.921 45.455 2.24 0.0 0.00 3.27
883 886 6.290294 AGAGCAAAGCAATTCCAACATAAT 57.710 33.333 0.00 0.0 0.00 1.28
1140 1144 7.494298 GGCTACTTTCAAATGAAAAGGTCAAAA 59.506 33.333 9.63 0.0 42.72 2.44
1174 1179 9.851686 TGATGTAATAGGCTCACTTCATTAATT 57.148 29.630 0.00 0.0 0.00 1.40
1261 1266 5.323371 TGGAAAGAAAGCCATATTTTCCG 57.677 39.130 9.08 0.0 46.12 4.30
1649 1654 2.084610 CGCAGGAGTGAATTGACTCA 57.915 50.000 23.79 0.0 43.70 3.41
2565 2570 8.406297 GGGGAGAATGTGATTTTTGTATACTTC 58.594 37.037 4.17 0.0 0.00 3.01
2575 2580 7.713507 TGATTTTTGTATACTTCGACCCCATAG 59.286 37.037 4.17 0.0 0.00 2.23
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
222 224 2.441750 TCCTTGCCCTAACTTGAACTGT 59.558 45.455 0.00 0.00 0.00 3.55
883 886 5.361285 GCTTAGAGGATCCTAAAGTGTCAGA 59.639 44.000 26.11 3.02 33.66 3.27
1140 1144 7.398024 AGTGAGCCTATTACATCAAGTTCTTT 58.602 34.615 0.00 0.00 0.00 2.52
1649 1654 9.200817 AGCTGGGTCATTTGTTTGTATAATTAT 57.799 29.630 2.97 2.97 0.00 1.28
2531 2536 2.816411 TCACATTCTCCCCGTAGAACT 58.184 47.619 0.00 0.00 38.28 3.01
2565 2570 0.180171 TTCATGCCACTATGGGGTCG 59.820 55.000 0.00 0.00 38.19 4.79
2575 2580 1.737838 TCCGATCAGTTTCATGCCAC 58.262 50.000 0.00 0.00 0.00 5.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.