Multiple sequence alignment - TraesCS7B01G487900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G487900 chr7B 100.000 2231 0 0 1 2231 742991115 742993345 0 4120
1 TraesCS7B01G487900 chr7B 98.970 2232 21 2 1 2231 716877111 716874881 0 3993
2 TraesCS7B01G487900 chr7B 98.479 2235 30 2 1 2231 716836900 716834666 0 3936
3 TraesCS7B01G487900 chr7A 99.059 2231 20 1 1 2231 60280983 60283212 0 4002
4 TraesCS7B01G487900 chrUn 98.925 2232 22 2 1 2231 186206751 186204521 0 3988
5 TraesCS7B01G487900 chr1A 98.879 2231 24 1 1 2231 498689557 498687328 0 3980
6 TraesCS7B01G487900 chr2B 98.521 2231 32 1 1 2231 391162679 391164908 0 3936
7 TraesCS7B01G487900 chr7D 98.997 2194 15 3 1 2189 382051749 382053940 0 3923
8 TraesCS7B01G487900 chr5A 98.390 2236 29 3 1 2231 238821138 238818905 0 3923


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G487900 chr7B 742991115 742993345 2230 False 4120 4120 100.000 1 2231 1 chr7B.!!$F1 2230
1 TraesCS7B01G487900 chr7B 716874881 716877111 2230 True 3993 3993 98.970 1 2231 1 chr7B.!!$R2 2230
2 TraesCS7B01G487900 chr7B 716834666 716836900 2234 True 3936 3936 98.479 1 2231 1 chr7B.!!$R1 2230
3 TraesCS7B01G487900 chr7A 60280983 60283212 2229 False 4002 4002 99.059 1 2231 1 chr7A.!!$F1 2230
4 TraesCS7B01G487900 chrUn 186204521 186206751 2230 True 3988 3988 98.925 1 2231 1 chrUn.!!$R1 2230
5 TraesCS7B01G487900 chr1A 498687328 498689557 2229 True 3980 3980 98.879 1 2231 1 chr1A.!!$R1 2230
6 TraesCS7B01G487900 chr2B 391162679 391164908 2229 False 3936 3936 98.521 1 2231 1 chr2B.!!$F1 2230
7 TraesCS7B01G487900 chr7D 382051749 382053940 2191 False 3923 3923 98.997 1 2189 1 chr7D.!!$F1 2188
8 TraesCS7B01G487900 chr5A 238818905 238821138 2233 True 3923 3923 98.390 1 2231 1 chr5A.!!$R1 2230

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
660 665 1.065491 TCCGTAGTACCCGAAGCACTA 60.065 52.381 4.25 0.0 0.0 2.74 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2013 2025 0.105593 GGCTGGATCTCAGAATCGCA 59.894 55.0 13.48 0.0 46.18 5.1 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
116 117 1.292223 GACTCCCAGTTACTGCGCA 59.708 57.895 10.98 10.98 0.00 6.09
353 354 1.303561 AGAGCAAAGCGCCAATGGA 60.304 52.632 2.05 0.00 44.04 3.41
660 665 1.065491 TCCGTAGTACCCGAAGCACTA 60.065 52.381 4.25 0.00 0.00 2.74
676 681 4.873945 AAGCACTAGAGTGATCCAGTAGCT 60.874 45.833 13.87 0.00 44.74 3.32
897 907 3.533547 CTTGGCTCCTCTTCATTCTCTG 58.466 50.000 0.00 0.00 0.00 3.35
949 959 6.002704 GGCAGAGATGGATAAGATCAAACAT 58.997 40.000 0.00 0.00 0.00 2.71
1757 1769 4.445305 GGTTGTTTTAGACACCTACCCACT 60.445 45.833 0.00 0.00 38.18 4.00
1829 1841 7.517604 AGGAATATTTACTACTGGGTCCATCAT 59.482 37.037 0.00 0.00 0.00 2.45
2013 2025 5.162637 TGCCCATTACTTCTACCCATCTAT 58.837 41.667 0.00 0.00 0.00 1.98
2096 2108 6.521527 AGGCTTTCTATTGAATATCCACCT 57.478 37.500 0.00 0.00 31.56 4.00
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
116 117 2.548904 GAGCACCTCAGTATACGATCGT 59.451 50.000 25.94 25.94 0.00 3.73
676 681 0.914417 CACTTCTAGGCCCCTTCCCA 60.914 60.000 0.00 0.00 0.00 4.37
949 959 6.108015 GCATTTCAAATGCTTCTTATTCCCA 58.892 36.000 25.16 0.00 41.52 4.37
1757 1769 1.877443 GGTGGCAAAGCGAAGTTTCTA 59.123 47.619 0.00 0.00 0.00 2.10
1829 1841 1.188871 TGCACCGGTATCTGGACACA 61.189 55.000 6.87 0.00 0.00 3.72
2013 2025 0.105593 GGCTGGATCTCAGAATCGCA 59.894 55.000 13.48 0.00 46.18 5.10
2096 2108 3.222173 ACCAGTCAAGCAATTACCACA 57.778 42.857 0.00 0.00 0.00 4.17


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.