Multiple sequence alignment - TraesCS7B01G487800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G487800 chr7B 100.000 2714 0 0 1 2714 742992913 742990200 0 5012
1 TraesCS7B01G487800 chr7B 98.969 2715 26 2 1 2714 716875313 716878026 0 4857
2 TraesCS7B01G487800 chr5A 99.118 2720 17 3 1 2714 19245370 19248088 0 4883
3 TraesCS7B01G487800 chr7D 99.081 2719 18 3 1 2714 382053550 382050834 0 4876
4 TraesCS7B01G487800 chr7D 98.825 2723 20 3 1 2714 381970293 381973012 0 4841
5 TraesCS7B01G487800 chr7D 98.859 2717 24 3 3 2714 381927470 381924756 0 4839
6 TraesCS7B01G487800 chr7D 98.823 2719 25 3 1 2714 203503470 203500754 0 4837
7 TraesCS7B01G487800 chr7A 99.005 2714 26 1 1 2714 60282780 60280068 0 4861
8 TraesCS7B01G487800 chr1A 98.895 2714 29 1 1 2714 498687760 498690472 0 4844
9 TraesCS7B01G487800 chr6D 98.824 2720 25 3 1 2714 124520995 124518277 0 4839


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G487800 chr7B 742990200 742992913 2713 True 5012 5012 100.000 1 2714 1 chr7B.!!$R1 2713
1 TraesCS7B01G487800 chr7B 716875313 716878026 2713 False 4857 4857 98.969 1 2714 1 chr7B.!!$F1 2713
2 TraesCS7B01G487800 chr5A 19245370 19248088 2718 False 4883 4883 99.118 1 2714 1 chr5A.!!$F1 2713
3 TraesCS7B01G487800 chr7D 382050834 382053550 2716 True 4876 4876 99.081 1 2714 1 chr7D.!!$R3 2713
4 TraesCS7B01G487800 chr7D 381970293 381973012 2719 False 4841 4841 98.825 1 2714 1 chr7D.!!$F1 2713
5 TraesCS7B01G487800 chr7D 381924756 381927470 2714 True 4839 4839 98.859 3 2714 1 chr7D.!!$R2 2711
6 TraesCS7B01G487800 chr7D 203500754 203503470 2716 True 4837 4837 98.823 1 2714 1 chr7D.!!$R1 2713
7 TraesCS7B01G487800 chr7A 60280068 60282780 2712 True 4861 4861 99.005 1 2714 1 chr7A.!!$R1 2713
8 TraesCS7B01G487800 chr1A 498687760 498690472 2712 False 4844 4844 98.895 1 2714 1 chr1A.!!$F1 2713
9 TraesCS7B01G487800 chr6D 124518277 124520995 2718 True 4839 4839 98.824 1 2714 1 chr6D.!!$R1 2713

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
41 42 1.877443 GGTGGCAAAGCGAAGTTTCTA 59.123 47.619 0.0 0.0 0.0 2.1 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2034 2047 0.762418 CATACGCAGGAATACCCCCA 59.238 55.0 0.0 0.0 36.73 4.96 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
41 42 1.877443 GGTGGCAAAGCGAAGTTTCTA 59.123 47.619 0.00 0.00 0.00 2.10
849 852 6.108015 GCATTTCAAATGCTTCTTATTCCCA 58.892 36.000 25.16 0.00 41.52 4.37
1122 1130 0.914417 CACTTCTAGGCCCCTTCCCA 60.914 60.000 0.00 0.00 0.00 4.37
1682 1695 2.548904 GAGCACCTCAGTATACGATCGT 59.451 50.000 25.94 25.94 0.00 3.73
1878 1891 2.337170 CTACGTGTCCGGTGCACA 59.663 61.111 20.43 10.80 38.78 4.57
1914 1927 2.838202 GTCTCCCAACCTTACTCATGGA 59.162 50.000 0.00 0.00 34.82 3.41
1963 1976 2.093106 CGCTAGTCACTACTCCCACTT 58.907 52.381 0.00 0.00 37.15 3.16
2422 2435 5.431420 AGAAACACGTGACATATTTGCAA 57.569 34.783 25.01 0.00 0.00 4.08
2507 2520 7.995052 AGATATCAGGTGCCCACATATATAA 57.005 36.000 5.32 0.00 0.00 0.98
2674 2687 2.861935 TCTGAACCGAACGTGAAAGTTC 59.138 45.455 11.82 11.82 45.05 3.01
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
41 42 4.445305 GGTTGTTTTAGACACCTACCCACT 60.445 45.833 0.00 0.00 38.18 4.00
849 852 6.002704 GGCAGAGATGGATAAGATCAAACAT 58.997 40.000 0.00 0.00 0.00 2.71
901 904 3.533547 CTTGGCTCCTCTTCATTCTCTG 58.466 50.000 0.00 0.00 0.00 3.35
1122 1130 4.873945 AAGCACTAGAGTGATCCAGTAGCT 60.874 45.833 13.87 0.00 44.74 3.32
1445 1458 1.303561 AGAGCAAAGCGCCAATGGA 60.304 52.632 2.05 0.00 44.04 3.41
1682 1695 1.292223 GACTCCCAGTTACTGCGCA 59.708 57.895 10.98 10.98 0.00 6.09
2034 2047 0.762418 CATACGCAGGAATACCCCCA 59.238 55.000 0.00 0.00 36.73 4.96
2422 2435 8.677148 TCTATTGCGCCTAAAATCTCTATTTT 57.323 30.769 4.18 0.00 45.21 1.82
2507 2520 5.011125 TCGGACTCAATCTCTCTTTTGACTT 59.989 40.000 0.00 0.00 0.00 3.01
2674 2687 4.034510 GTGAATAGCCGTCTGATGGAAAAG 59.965 45.833 19.98 0.00 0.00 2.27


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.