Multiple sequence alignment - TraesCS7B01G487700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G487700 chr7B 100.000 2594 0 0 1 2594 742989412 742992005 0 4791
1 TraesCS7B01G487700 chr7B 98.959 2594 26 1 1 2594 716878814 716876222 0 4639
2 TraesCS7B01G487700 chr5A 99.000 2601 18 4 1 2594 19248878 19246279 0 4652
3 TraesCS7B01G487700 chr5A 98.308 2600 36 4 1 2594 238822841 238820244 0 4551
4 TraesCS7B01G487700 chr7D 98.923 2601 20 4 1 2594 382050044 382052643 0 4641
5 TraesCS7B01G487700 chr7D 98.923 2600 21 3 1 2594 381923967 381926565 0 4639
6 TraesCS7B01G487700 chr7D 98.885 2600 22 3 1 2594 203499965 203502563 0 4634
7 TraesCS7B01G487700 chr7D 98.810 2604 18 4 1 2594 381973801 381971201 0 4625
8 TraesCS7B01G487700 chr7A 98.882 2595 27 2 1 2594 60279279 60281872 0 4630


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G487700 chr7B 742989412 742992005 2593 False 4791 4791 100.000 1 2594 1 chr7B.!!$F1 2593
1 TraesCS7B01G487700 chr7B 716876222 716878814 2592 True 4639 4639 98.959 1 2594 1 chr7B.!!$R1 2593
2 TraesCS7B01G487700 chr5A 19246279 19248878 2599 True 4652 4652 99.000 1 2594 1 chr5A.!!$R1 2593
3 TraesCS7B01G487700 chr5A 238820244 238822841 2597 True 4551 4551 98.308 1 2594 1 chr5A.!!$R2 2593
4 TraesCS7B01G487700 chr7D 382050044 382052643 2599 False 4641 4641 98.923 1 2594 1 chr7D.!!$F3 2593
5 TraesCS7B01G487700 chr7D 381923967 381926565 2598 False 4639 4639 98.923 1 2594 1 chr7D.!!$F2 2593
6 TraesCS7B01G487700 chr7D 203499965 203502563 2598 False 4634 4634 98.885 1 2594 1 chr7D.!!$F1 2593
7 TraesCS7B01G487700 chr7D 381971201 381973801 2600 True 4625 4625 98.810 1 2594 1 chr7D.!!$R1 2593
8 TraesCS7B01G487700 chr7A 60279279 60281872 2593 False 4630 4630 98.882 1 2594 1 chr7A.!!$F1 2593

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
96 97 2.584608 CTCGCCCCTTCCGAATGT 59.415 61.111 0.0 0.0 33.92 2.71 F
1467 1470 0.762418 CATACGCAGGAATACCCCCA 59.238 55.000 0.0 0.0 36.73 4.96 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1538 1541 2.093106 CGCTAGTCACTACTCCCACTT 58.907 52.381 0.0 0.0 37.15 3.16 R
2379 2387 0.914417 CACTTCTAGGCCCCTTCCCA 60.914 60.000 0.0 0.0 0.00 4.37 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
96 97 2.584608 CTCGCCCCTTCCGAATGT 59.415 61.111 0.00 0.00 33.92 2.71
231 232 3.747010 GGGAGGAAGAAAGAAAGTCGAAC 59.253 47.826 0.00 0.00 0.00 3.95
756 759 3.058160 GCAGCGTGTGGAATGGCT 61.058 61.111 0.00 0.00 35.84 4.75
827 830 4.034510 GTGAATAGCCGTCTGATGGAAAAG 59.965 45.833 19.98 0.00 0.00 2.27
994 997 5.011125 TCGGACTCAATCTCTCTTTTGACTT 59.989 40.000 0.00 0.00 0.00 3.01
1079 1082 8.677148 TCTATTGCGCCTAAAATCTCTATTTT 57.323 30.769 4.18 0.00 45.21 1.82
1467 1470 0.762418 CATACGCAGGAATACCCCCA 59.238 55.000 0.00 0.00 36.73 4.96
1819 1822 1.292223 GACTCCCAGTTACTGCGCA 59.708 57.895 10.98 10.98 0.00 6.09
2056 2059 1.303561 AGAGCAAAGCGCCAATGGA 60.304 52.632 2.05 0.00 44.04 3.41
2363 2371 1.065491 TCCGTAGTACCCGAAGCACTA 60.065 52.381 4.25 0.00 0.00 2.74
2379 2387 4.873945 AAGCACTAGAGTGATCCAGTAGCT 60.874 45.833 13.87 0.00 44.74 3.32
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
96 97 3.119459 CGAGAACTTCAGGATCGGAGAAA 60.119 47.826 0.00 0.00 43.58 2.52
231 232 1.001406 AGGACAAAGGAGAAGACGCTG 59.999 52.381 0.00 0.00 0.00 5.18
756 759 0.911769 ATCCATTTGGTCCGCTCTCA 59.088 50.000 0.00 0.00 36.34 3.27
827 830 2.861935 TCTGAACCGAACGTGAAAGTTC 59.138 45.455 11.82 11.82 45.05 3.01
994 997 7.995052 AGATATCAGGTGCCCACATATATAA 57.005 36.000 5.32 0.00 0.00 0.98
1079 1082 5.431420 AGAAACACGTGACATATTTGCAA 57.569 34.783 25.01 0.00 0.00 4.08
1538 1541 2.093106 CGCTAGTCACTACTCCCACTT 58.907 52.381 0.00 0.00 37.15 3.16
1587 1590 2.838202 GTCTCCCAACCTTACTCATGGA 59.162 50.000 0.00 0.00 34.82 3.41
1623 1626 2.337170 CTACGTGTCCGGTGCACA 59.663 61.111 20.43 10.80 38.78 4.57
1819 1822 2.548904 GAGCACCTCAGTATACGATCGT 59.451 50.000 25.94 25.94 0.00 3.73
2379 2387 0.914417 CACTTCTAGGCCCCTTCCCA 60.914 60.000 0.00 0.00 0.00 4.37


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.