Multiple sequence alignment - TraesCS7B01G487600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G487600 chr7B 100.000 2439 0 0 1 2439 742991047 742988609 0 4505
1 TraesCS7B01G487600 chr7B 98.770 2440 25 3 1 2439 716877179 716879614 0 4335
2 TraesCS7B01G487600 chr5A 98.977 2444 18 5 1 2439 19247241 19249682 0 4368
3 TraesCS7B01G487600 chr7D 98.893 2440 23 3 1 2439 381925603 381923167 0 4353
4 TraesCS7B01G487600 chr7D 98.812 2441 21 4 1 2439 382051681 382049247 0 4340
5 TraesCS7B01G487600 chr7D 98.689 2441 25 5 1 2439 203501601 203499166 0 4324
6 TraesCS7B01G487600 chrUn 98.852 2440 27 1 1 2439 186206819 186209258 0 4349
7 TraesCS7B01G487600 chr7A 98.770 2440 27 2 1 2439 60280915 60278478 0 4337
8 TraesCS7B01G487600 chr6D 98.730 2440 25 4 1 2439 124519124 124516690 0 4329
9 TraesCS7B01G487600 chr1A 98.689 2440 25 4 1 2439 498689625 498692058 0 4322


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G487600 chr7B 742988609 742991047 2438 True 4505 4505 100.000 1 2439 1 chr7B.!!$R1 2438
1 TraesCS7B01G487600 chr7B 716877179 716879614 2435 False 4335 4335 98.770 1 2439 1 chr7B.!!$F1 2438
2 TraesCS7B01G487600 chr5A 19247241 19249682 2441 False 4368 4368 98.977 1 2439 1 chr5A.!!$F1 2438
3 TraesCS7B01G487600 chr7D 381923167 381925603 2436 True 4353 4353 98.893 1 2439 1 chr7D.!!$R2 2438
4 TraesCS7B01G487600 chr7D 382049247 382051681 2434 True 4340 4340 98.812 1 2439 1 chr7D.!!$R3 2438
5 TraesCS7B01G487600 chr7D 203499166 203501601 2435 True 4324 4324 98.689 1 2439 1 chr7D.!!$R1 2438
6 TraesCS7B01G487600 chrUn 186206819 186209258 2439 False 4349 4349 98.852 1 2439 1 chrUn.!!$F1 2438
7 TraesCS7B01G487600 chr7A 60278478 60280915 2437 True 4337 4337 98.770 1 2439 1 chr7A.!!$R1 2438
8 TraesCS7B01G487600 chr6D 124516690 124519124 2434 True 4329 4329 98.730 1 2439 1 chr6D.!!$R1 2438
9 TraesCS7B01G487600 chr1A 498689625 498692058 2433 False 4322 4322 98.689 1 2439 1 chr1A.!!$F1 2438

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
879 880 0.911769 ATCCATTTGGTCCGCTCTCA 59.088 50.0 0.0 0.0 36.34 3.27 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2160 2174 0.322546 GGCGACCCAATGACCTTTCT 60.323 55.0 0.0 0.0 0.0 2.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
48 49 2.838202 GTCTCCCAACCTTACTCATGGA 59.162 50.000 0.00 0.00 34.82 3.41
97 98 2.093106 CGCTAGTCACTACTCCCACTT 58.907 52.381 0.00 0.00 37.15 3.16
556 557 5.431420 AGAAACACGTGACATATTTGCAA 57.569 34.783 25.01 0.00 0.00 4.08
641 642 7.995052 AGATATCAGGTGCCCACATATATAA 57.005 36.000 5.32 0.00 0.00 0.98
808 809 2.861935 TCTGAACCGAACGTGAAAGTTC 59.138 45.455 11.82 11.82 45.05 3.01
879 880 0.911769 ATCCATTTGGTCCGCTCTCA 59.088 50.000 0.00 0.00 36.34 3.27
1539 1542 3.119459 CGAGAACTTCAGGATCGGAGAAA 60.119 47.826 0.00 0.00 43.58 2.52
1981 1995 3.886123 CCCCCTTTTGAATCGACAGTAT 58.114 45.455 0.00 0.00 0.00 2.12
1982 1996 4.685030 GCCCCCTTTTGAATCGACAGTATA 60.685 45.833 0.00 0.00 0.00 1.47
2117 2131 4.016444 CTGGAGGGCAAGCTGTTTTATAA 58.984 43.478 0.00 0.00 0.00 0.98
2160 2174 2.933906 GCGACGAATACTTCCAATTCCA 59.066 45.455 0.00 0.00 30.98 3.53
2194 2208 2.423577 GTCGCCTTTGGAAGCTAAAGA 58.576 47.619 8.71 0.00 37.33 2.52
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
168 169 0.762418 CATACGCAGGAATACCCCCA 59.238 55.000 0.00 0.0 36.73 4.96
556 557 8.677148 TCTATTGCGCCTAAAATCTCTATTTT 57.323 30.769 4.18 0.0 45.21 1.82
641 642 5.011125 TCGGACTCAATCTCTCTTTTGACTT 59.989 40.000 0.00 0.0 0.00 3.01
808 809 4.034510 GTGAATAGCCGTCTGATGGAAAAG 59.965 45.833 19.98 0.0 0.00 2.27
879 880 3.058160 GCAGCGTGTGGAATGGCT 61.058 61.111 0.00 0.0 35.84 4.75
1539 1542 2.584608 CTCGCCCCTTCCGAATGT 59.415 61.111 0.00 0.0 33.92 2.71
2117 2131 4.164413 GCCCTACCCTAAGAAAGAAGTCAT 59.836 45.833 0.00 0.0 0.00 3.06
2160 2174 0.322546 GGCGACCCAATGACCTTTCT 60.323 55.000 0.00 0.0 0.00 2.52
2194 2208 2.370849 TCCCGGCTTTCTACAACTTTCT 59.629 45.455 0.00 0.0 0.00 2.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.