Multiple sequence alignment - TraesCS7B01G487500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G487500 chr7B 100.000 2573 0 0 1 2573 742984797 742987369 0 4752
1 TraesCS7B01G487500 chr7B 98.873 2574 28 1 1 2573 716843187 716840614 0 4591
2 TraesCS7B01G487500 chr7B 98.835 2575 28 1 1 2573 716883428 716880854 0 4588
3 TraesCS7B01G487500 chr5A 98.951 2575 25 1 1 2573 19253496 19250922 0 4604
4 TraesCS7B01G487500 chr6D 98.756 2573 24 2 1 2573 124512887 124515451 0 4567
5 TraesCS7B01G487500 chr7A 98.641 2575 28 5 1 2573 120845799 120843230 0 4554
6 TraesCS7B01G487500 chr7A 98.485 2575 35 3 1 2573 60274667 60277239 0 4536
7 TraesCS7B01G487500 chr7D 98.601 2573 28 3 1 2573 203495362 203497926 0 4545
8 TraesCS7B01G487500 chr7D 98.368 2573 34 2 1 2573 381978399 381975835 0 4512
9 TraesCS7B01G487500 chr2B 98.212 2573 46 0 1 2573 112836389 112838961 0 4497


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G487500 chr7B 742984797 742987369 2572 False 4752 4752 100.000 1 2573 1 chr7B.!!$F1 2572
1 TraesCS7B01G487500 chr7B 716840614 716843187 2573 True 4591 4591 98.873 1 2573 1 chr7B.!!$R1 2572
2 TraesCS7B01G487500 chr7B 716880854 716883428 2574 True 4588 4588 98.835 1 2573 1 chr7B.!!$R2 2572
3 TraesCS7B01G487500 chr5A 19250922 19253496 2574 True 4604 4604 98.951 1 2573 1 chr5A.!!$R1 2572
4 TraesCS7B01G487500 chr6D 124512887 124515451 2564 False 4567 4567 98.756 1 2573 1 chr6D.!!$F1 2572
5 TraesCS7B01G487500 chr7A 120843230 120845799 2569 True 4554 4554 98.641 1 2573 1 chr7A.!!$R1 2572
6 TraesCS7B01G487500 chr7A 60274667 60277239 2572 False 4536 4536 98.485 1 2573 1 chr7A.!!$F1 2572
7 TraesCS7B01G487500 chr7D 203495362 203497926 2564 False 4545 4545 98.601 1 2573 1 chr7D.!!$F1 2572
8 TraesCS7B01G487500 chr7D 381975835 381978399 2564 True 4512 4512 98.368 1 2573 1 chr7D.!!$R1 2572
9 TraesCS7B01G487500 chr2B 112836389 112838961 2572 False 4497 4497 98.212 1 2573 1 chr2B.!!$F1 2572

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
819 821 2.203112 GCATGCAGCCGATCCTGA 60.203 61.111 14.21 0.0 37.23 3.86 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2036 2038 1.183549 GGAAAGGAGGCGACTAGTCA 58.816 55.0 22.37 0.0 44.43 3.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
55 56 2.567615 CTGCTTCCACCTTACCACTACT 59.432 50.000 0.00 0.0 0.00 2.57
402 404 6.560253 ATTCAGTATCAGAAAACACACCAC 57.440 37.500 0.00 0.0 0.00 4.16
819 821 2.203112 GCATGCAGCCGATCCTGA 60.203 61.111 14.21 0.0 37.23 3.86
927 929 2.833957 GGTCGGACCAACCCAACT 59.166 61.111 22.10 0.0 38.42 3.16
1075 1077 8.746052 ATGGGTACATAAAATGAAAAGATCGA 57.254 30.769 0.00 0.0 34.99 3.59
1148 1150 5.480073 TGTGCTTTCTAAAATGGCATACCTT 59.520 36.000 0.00 0.0 36.63 3.50
1299 1301 5.571784 ACGAAGTAACACGAATATCTCCA 57.428 39.130 0.00 0.0 41.94 3.86
2136 2138 0.613012 GCAATGAGGGGGAAGCTGTT 60.613 55.000 0.00 0.0 0.00 3.16
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
55 56 5.830991 AGGTTTCTACAATACAAAGCACCAA 59.169 36.000 0.00 0.0 31.34 3.67
721 723 1.287425 CATCGCTCGGGGAAAAGTAC 58.713 55.000 0.00 0.0 0.00 2.73
927 929 1.153901 GACTCGTCGGAAATCGCCA 60.154 57.895 0.00 0.0 39.05 5.69
1148 1150 4.449743 CGATCGAAACTTGAACCCTTGTAA 59.550 41.667 10.26 0.0 0.00 2.41
1262 1264 4.209452 ACTTCGTATGCACTTGTTTGTG 57.791 40.909 0.00 0.0 40.62 3.33
1276 1278 6.317140 ACTGGAGATATTCGTGTTACTTCGTA 59.683 38.462 0.00 0.0 0.00 3.43
1299 1301 5.069781 GGCTGATGGAAATAGACTGACTACT 59.930 44.000 0.00 0.0 33.62 2.57
2036 2038 1.183549 GGAAAGGAGGCGACTAGTCA 58.816 55.000 22.37 0.0 44.43 3.41
2136 2138 1.909700 CAAGGGGCAAAGCTTCTACA 58.090 50.000 0.00 0.0 0.00 2.74


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.