Multiple sequence alignment - TraesCS7B01G487400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G487400 chr7B 100.000 2960 0 0 1 2960 742986404 742983445 0 5467
1 TraesCS7B01G487400 chr7B 98.921 2132 23 0 1 2132 716841580 716843711 0 3810
2 TraesCS7B01G487400 chr7B 98.781 2133 25 1 1 2132 716881821 716883953 0 3794
3 TraesCS7B01G487400 chr6D 98.734 2132 23 1 1 2132 124514490 124512363 0 3784
4 TraesCS7B01G487400 chr2B 98.687 2132 27 1 1 2132 391079892 391082022 0 3781
5 TraesCS7B01G487400 chr7A 98.640 2133 27 2 1 2132 120844192 120846323 0 3777
6 TraesCS7B01G487400 chr7A 98.593 2132 28 2 1 2132 60276273 60274144 0 3770
7 TraesCS7B01G487400 chr7A 98.786 824 9 1 2137 2960 46418540 46417718 0 1465
8 TraesCS7B01G487400 chr7D 98.546 2132 27 1 1 2132 203496965 203494838 0 3762
9 TraesCS7B01G487400 chr7D 98.546 2132 27 1 1 2132 381976796 381978923 0 3762
10 TraesCS7B01G487400 chr1B 98.452 2132 31 2 1 2132 672557173 672559302 0 3753
11 TraesCS7B01G487400 chr5A 99.272 824 5 1 2137 2960 300080660 300081482 0 1487
12 TraesCS7B01G487400 chr6A 99.150 824 6 1 2137 2960 289136302 289137124 0 1482
13 TraesCS7B01G487400 chr6A 99.029 824 7 1 2137 2960 608866953 608867775 0 1476
14 TraesCS7B01G487400 chr6A 98.908 824 8 1 2137 2960 84420160 84419338 0 1471
15 TraesCS7B01G487400 chr2A 99.029 824 7 1 2137 2960 735200328 735201150 0 1476
16 TraesCS7B01G487400 chr3B 98.908 824 7 2 2137 2960 575867210 575868031 0 1471
17 TraesCS7B01G487400 chr3B 98.786 824 9 1 2137 2960 92207276 92208098 0 1465
18 TraesCS7B01G487400 chr3B 98.786 824 9 1 2137 2960 92257019 92256197 0 1465


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G487400 chr7B 742983445 742986404 2959 True 5467 5467 100.000 1 2960 1 chr7B.!!$R1 2959
1 TraesCS7B01G487400 chr7B 716841580 716843711 2131 False 3810 3810 98.921 1 2132 1 chr7B.!!$F1 2131
2 TraesCS7B01G487400 chr7B 716881821 716883953 2132 False 3794 3794 98.781 1 2132 1 chr7B.!!$F2 2131
3 TraesCS7B01G487400 chr6D 124512363 124514490 2127 True 3784 3784 98.734 1 2132 1 chr6D.!!$R1 2131
4 TraesCS7B01G487400 chr2B 391079892 391082022 2130 False 3781 3781 98.687 1 2132 1 chr2B.!!$F1 2131
5 TraesCS7B01G487400 chr7A 120844192 120846323 2131 False 3777 3777 98.640 1 2132 1 chr7A.!!$F1 2131
6 TraesCS7B01G487400 chr7A 60274144 60276273 2129 True 3770 3770 98.593 1 2132 1 chr7A.!!$R2 2131
7 TraesCS7B01G487400 chr7A 46417718 46418540 822 True 1465 1465 98.786 2137 2960 1 chr7A.!!$R1 823
8 TraesCS7B01G487400 chr7D 203494838 203496965 2127 True 3762 3762 98.546 1 2132 1 chr7D.!!$R1 2131
9 TraesCS7B01G487400 chr7D 381976796 381978923 2127 False 3762 3762 98.546 1 2132 1 chr7D.!!$F1 2131
10 TraesCS7B01G487400 chr1B 672557173 672559302 2129 False 3753 3753 98.452 1 2132 1 chr1B.!!$F1 2131
11 TraesCS7B01G487400 chr5A 300080660 300081482 822 False 1487 1487 99.272 2137 2960 1 chr5A.!!$F1 823
12 TraesCS7B01G487400 chr6A 289136302 289137124 822 False 1482 1482 99.150 2137 2960 1 chr6A.!!$F1 823
13 TraesCS7B01G487400 chr6A 608866953 608867775 822 False 1476 1476 99.029 2137 2960 1 chr6A.!!$F2 823
14 TraesCS7B01G487400 chr6A 84419338 84420160 822 True 1471 1471 98.908 2137 2960 1 chr6A.!!$R1 823
15 TraesCS7B01G487400 chr2A 735200328 735201150 822 False 1476 1476 99.029 2137 2960 1 chr2A.!!$F1 823
16 TraesCS7B01G487400 chr3B 575867210 575868031 821 False 1471 1471 98.908 2137 2960 1 chr3B.!!$F2 823
17 TraesCS7B01G487400 chr3B 92207276 92208098 822 False 1465 1465 98.786 2137 2960 1 chr3B.!!$F1 823
18 TraesCS7B01G487400 chr3B 92256197 92257019 822 True 1465 1465 98.786 2137 2960 1 chr3B.!!$R1 823

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
680 681 1.153901 GACTCGTCGGAAATCGCCA 60.154 57.895 0.0 0.0 39.05 5.69 F
886 887 1.287425 CATCGCTCGGGGAAAAGTAC 58.713 55.000 0.0 0.0 0.00 2.73 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1849 1851 1.000385 CAAGGGTTTGCAAAGCATCGA 60.000 47.619 34.69 2.01 38.76 3.59 R
2844 2847 1.606668 GACTATCCGACTCAGCTCTGG 59.393 57.143 0.00 0.00 0.00 3.86 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
308 309 5.069781 GGCTGATGGAAATAGACTGACTACT 59.930 44.000 0.00 0.0 33.62 2.57
331 332 6.317140 ACTGGAGATATTCGTGTTACTTCGTA 59.683 38.462 0.00 0.0 0.00 3.43
345 346 4.209452 ACTTCGTATGCACTTGTTTGTG 57.791 40.909 0.00 0.0 40.62 3.33
459 460 4.449743 CGATCGAAACTTGAACCCTTGTAA 59.550 41.667 10.26 0.0 0.00 2.41
680 681 1.153901 GACTCGTCGGAAATCGCCA 60.154 57.895 0.00 0.0 39.05 5.69
886 887 1.287425 CATCGCTCGGGGAAAAGTAC 58.713 55.000 0.00 0.0 0.00 2.73
1552 1554 5.830991 AGGTTTCTACAATACAAAGCACCAA 59.169 36.000 0.00 0.0 31.34 3.67
1849 1851 5.819991 TGCTCCCTATCAAACTCAATCTTT 58.180 37.500 0.00 0.0 0.00 2.52
2132 2135 8.827177 AAGAATCGTCAATGTTTAGTTGAGTA 57.173 30.769 0.00 0.0 36.35 2.59
2133 2136 9.436957 AAGAATCGTCAATGTTTAGTTGAGTAT 57.563 29.630 0.00 0.0 36.35 2.12
2134 2137 9.436957 AGAATCGTCAATGTTTAGTTGAGTATT 57.563 29.630 0.00 0.0 36.35 1.89
2315 2318 1.215673 TCAACTAGAGCCGAGGAGGAT 59.784 52.381 0.00 0.0 44.48 3.24
2738 2741 1.968493 AGGAAGTGTCAAAGGCGTCTA 59.032 47.619 0.00 0.0 0.00 2.59
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
308 309 5.571784 ACGAAGTAACACGAATATCTCCA 57.428 39.130 0.00 0.00 41.94 3.86
459 460 5.480073 TGTGCTTTCTAAAATGGCATACCTT 59.520 36.000 0.00 0.00 36.63 3.50
532 533 8.746052 ATGGGTACATAAAATGAAAAGATCGA 57.254 30.769 0.00 0.00 34.99 3.59
680 681 2.833957 GGTCGGACCAACCCAACT 59.166 61.111 22.10 0.00 38.42 3.16
788 789 2.203112 GCATGCAGCCGATCCTGA 60.203 61.111 14.21 0.00 37.23 3.86
1205 1206 6.560253 ATTCAGTATCAGAAAACACACCAC 57.440 37.500 0.00 0.00 0.00 4.16
1552 1554 2.567615 CTGCTTCCACCTTACCACTACT 59.432 50.000 0.00 0.00 0.00 2.57
1808 1810 6.044682 GGGAGCAGATTTATGTTCAAATTGG 58.955 40.000 0.00 0.00 32.55 3.16
1849 1851 1.000385 CAAGGGTTTGCAAAGCATCGA 60.000 47.619 34.69 2.01 38.76 3.59
2132 2135 8.869109 TGTTTGATTGGGAAGACAGAATAAAAT 58.131 29.630 0.00 0.00 0.00 1.82
2133 2136 8.243961 TGTTTGATTGGGAAGACAGAATAAAA 57.756 30.769 0.00 0.00 0.00 1.52
2134 2137 7.831691 TGTTTGATTGGGAAGACAGAATAAA 57.168 32.000 0.00 0.00 0.00 1.40
2135 2138 8.421249 AATGTTTGATTGGGAAGACAGAATAA 57.579 30.769 0.00 0.00 0.00 1.40
2844 2847 1.606668 GACTATCCGACTCAGCTCTGG 59.393 57.143 0.00 0.00 0.00 3.86


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.