Multiple sequence alignment - TraesCS7B01G487300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G487300 chr7B 100.000 2447 0 0 1 2447 742964241 742966687 0 4519
1 TraesCS7B01G487300 chr7B 98.157 597 6 1 1 592 52968962 52969558 0 1037
2 TraesCS7B01G487300 chr3B 98.086 1933 37 0 515 2447 92237464 92239396 0 3365
3 TraesCS7B01G487300 chr3B 98.086 1933 36 1 515 2447 92226953 92225022 0 3363
4 TraesCS7B01G487300 chr3B 98.529 1903 28 0 545 2447 201584058 201582156 0 3360
5 TraesCS7B01G487300 chr1B 97.204 1931 48 2 521 2447 135100039 135098111 0 3262
6 TraesCS7B01G487300 chr1B 97.573 412 6 1 515 922 339013313 339013724 0 702
7 TraesCS7B01G487300 chr2B 98.600 1786 25 0 515 2300 449203332 449201547 0 3160
8 TraesCS7B01G487300 chr6D 98.693 1607 20 1 842 2447 430466784 430465178 0 2850
9 TraesCS7B01G487300 chr3D 98.692 1606 21 0 842 2447 202625480 202623875 0 2850
10 TraesCS7B01G487300 chr5A 98.007 1606 32 0 842 2447 162145416 162143811 0 2789
11 TraesCS7B01G487300 chr4D 97.634 1606 37 1 842 2447 97361819 97363423 0 2754
12 TraesCS7B01G487300 chr6A 98.827 597 2 1 1 592 64684876 64685472 0 1059
13 TraesCS7B01G487300 chr7A 98.030 609 7 1 1 604 211224890 211224282 0 1053
14 TraesCS7B01G487300 chr7A 97.537 609 10 1 1 604 60255752 60255144 0 1037
15 TraesCS7B01G487300 chr7A 98.157 597 6 1 1 592 120864698 120865294 0 1037
16 TraesCS7B01G487300 chr3A 98.030 609 7 1 1 604 633124454 633123846 0 1053
17 TraesCS7B01G487300 chr4B 98.325 597 5 1 1 592 209061520 209062116 0 1042
18 TraesCS7B01G487300 chr4B 97.701 609 9 1 1 604 209284886 209284278 0 1042
19 TraesCS7B01G487300 chr4B 97.537 609 10 1 1 604 209135799 209135191 0 1037
20 TraesCS7B01G487300 chr5B 98.039 459 5 1 515 969 533042544 533043002 0 795
21 TraesCS7B01G487300 chr6B 97.573 412 6 1 515 922 297426401 297426812 0 702
22 TraesCS7B01G487300 chr6B 97.330 412 6 2 515 922 388026724 388027134 0 695


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G487300 chr7B 742964241 742966687 2446 False 4519 4519 100.000 1 2447 1 chr7B.!!$F2 2446
1 TraesCS7B01G487300 chr7B 52968962 52969558 596 False 1037 1037 98.157 1 592 1 chr7B.!!$F1 591
2 TraesCS7B01G487300 chr3B 92237464 92239396 1932 False 3365 3365 98.086 515 2447 1 chr3B.!!$F1 1932
3 TraesCS7B01G487300 chr3B 92225022 92226953 1931 True 3363 3363 98.086 515 2447 1 chr3B.!!$R1 1932
4 TraesCS7B01G487300 chr3B 201582156 201584058 1902 True 3360 3360 98.529 545 2447 1 chr3B.!!$R2 1902
5 TraesCS7B01G487300 chr1B 135098111 135100039 1928 True 3262 3262 97.204 521 2447 1 chr1B.!!$R1 1926
6 TraesCS7B01G487300 chr2B 449201547 449203332 1785 True 3160 3160 98.600 515 2300 1 chr2B.!!$R1 1785
7 TraesCS7B01G487300 chr6D 430465178 430466784 1606 True 2850 2850 98.693 842 2447 1 chr6D.!!$R1 1605
8 TraesCS7B01G487300 chr3D 202623875 202625480 1605 True 2850 2850 98.692 842 2447 1 chr3D.!!$R1 1605
9 TraesCS7B01G487300 chr5A 162143811 162145416 1605 True 2789 2789 98.007 842 2447 1 chr5A.!!$R1 1605
10 TraesCS7B01G487300 chr4D 97361819 97363423 1604 False 2754 2754 97.634 842 2447 1 chr4D.!!$F1 1605
11 TraesCS7B01G487300 chr6A 64684876 64685472 596 False 1059 1059 98.827 1 592 1 chr6A.!!$F1 591
12 TraesCS7B01G487300 chr7A 211224282 211224890 608 True 1053 1053 98.030 1 604 1 chr7A.!!$R2 603
13 TraesCS7B01G487300 chr7A 60255144 60255752 608 True 1037 1037 97.537 1 604 1 chr7A.!!$R1 603
14 TraesCS7B01G487300 chr7A 120864698 120865294 596 False 1037 1037 98.157 1 592 1 chr7A.!!$F1 591
15 TraesCS7B01G487300 chr3A 633123846 633124454 608 True 1053 1053 98.030 1 604 1 chr3A.!!$R1 603
16 TraesCS7B01G487300 chr4B 209061520 209062116 596 False 1042 1042 98.325 1 592 1 chr4B.!!$F1 591
17 TraesCS7B01G487300 chr4B 209284278 209284886 608 True 1042 1042 97.701 1 604 1 chr4B.!!$R2 603
18 TraesCS7B01G487300 chr4B 209135191 209135799 608 True 1037 1037 97.537 1 604 1 chr4B.!!$R1 603

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
786 796 7.021196 CGACAATGGTATGGTACTTTTTCTTG 58.979 38.462 0.0 0.0 0.0 3.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2119 2130 5.370679 GTTAGTTAGGACCAGTGAAAACCA 58.629 41.667 0.0 0.0 0.0 3.67 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
786 796 7.021196 CGACAATGGTATGGTACTTTTTCTTG 58.979 38.462 0.00 0.0 0.00 3.02
1027 1037 4.262592 GGGACTTTGATGGTGAGCAAAAAT 60.263 41.667 0.00 0.0 37.04 1.82
1347 1357 9.102757 GAGAAATGTTCATTTGCTGAGATACTA 57.897 33.333 14.29 0.0 34.68 1.82
1691 1701 4.158949 TCAGGTCGAATGAATACGAAAGGA 59.841 41.667 0.00 0.0 40.12 3.36
1899 1910 7.382488 GCTGGGTAATTTCTCAGAAAGTTTTTC 59.618 37.037 15.53 0.0 0.00 2.29
2119 2130 1.507141 CTTCGCCTTCACCAAGCGTT 61.507 55.000 3.39 0.0 33.51 4.84
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
786 796 3.074412 ACACCCACACAATCTCGATTTC 58.926 45.455 0.00 0.0 0.00 2.17
1347 1357 1.486726 CCCCTCTTTCGGTAAGCATCT 59.513 52.381 0.00 0.0 33.66 2.90
1691 1701 7.507956 TCATGGCTTATTGATTTGATTGATCCT 59.492 33.333 0.00 0.0 0.00 3.24
1899 1910 6.540189 CACCTAGGAATAGGAATCAACAACAG 59.460 42.308 17.98 0.0 39.60 3.16
2119 2130 5.370679 GTTAGTTAGGACCAGTGAAAACCA 58.629 41.667 0.00 0.0 0.00 3.67
2257 2268 5.374071 ACGTGGACCAAAAGACTAAGAAAT 58.626 37.500 0.00 0.0 0.00 2.17


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.