Multiple sequence alignment - TraesCS7B01G487200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G487200 chr7B 100.000 2317 0 0 1 2317 742954450 742956766 0.000000e+00 4279
1 TraesCS7B01G487200 chr7B 99.137 2318 19 1 1 2317 716910713 716908396 0.000000e+00 4169
2 TraesCS7B01G487200 chr7B 98.921 2318 23 2 1 2317 716778896 716776580 0.000000e+00 4141
3 TraesCS7B01G487200 chr7A 99.051 2319 20 1 1 2317 60349348 60347030 0.000000e+00 4159
4 TraesCS7B01G487200 chr7A 98.793 2320 25 1 1 2317 60174234 60176553 0.000000e+00 4126
5 TraesCS7B01G487200 chr7A 98.117 1487 28 0 831 2317 211308937 211310423 0.000000e+00 2591
6 TraesCS7B01G487200 chr7A 97.848 1487 32 0 831 2317 563545462 563546948 0.000000e+00 2569
7 TraesCS7B01G487200 chr7A 98.944 1231 11 2 1 1230 60158350 60157121 0.000000e+00 2200
8 TraesCS7B01G487200 chr7A 98.841 345 4 0 253 597 683284332 683283988 1.180000e-172 616
9 TraesCS7B01G487200 chr5A 98.965 2318 23 1 1 2317 16538870 16536553 0.000000e+00 4146
10 TraesCS7B01G487200 chr2B 98.749 2319 26 2 1 2317 391172732 391170415 0.000000e+00 4119
11 TraesCS7B01G487200 chr1B 98.619 2317 32 0 1 2317 583567260 583569576 0.000000e+00 4102


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G487200 chr7B 742954450 742956766 2316 False 4279 4279 100.000 1 2317 1 chr7B.!!$F1 2316
1 TraesCS7B01G487200 chr7B 716908396 716910713 2317 True 4169 4169 99.137 1 2317 1 chr7B.!!$R2 2316
2 TraesCS7B01G487200 chr7B 716776580 716778896 2316 True 4141 4141 98.921 1 2317 1 chr7B.!!$R1 2316
3 TraesCS7B01G487200 chr7A 60347030 60349348 2318 True 4159 4159 99.051 1 2317 1 chr7A.!!$R2 2316
4 TraesCS7B01G487200 chr7A 60174234 60176553 2319 False 4126 4126 98.793 1 2317 1 chr7A.!!$F1 2316
5 TraesCS7B01G487200 chr7A 211308937 211310423 1486 False 2591 2591 98.117 831 2317 1 chr7A.!!$F2 1486
6 TraesCS7B01G487200 chr7A 563545462 563546948 1486 False 2569 2569 97.848 831 2317 1 chr7A.!!$F3 1486
7 TraesCS7B01G487200 chr7A 60157121 60158350 1229 True 2200 2200 98.944 1 1230 1 chr7A.!!$R1 1229
8 TraesCS7B01G487200 chr5A 16536553 16538870 2317 True 4146 4146 98.965 1 2317 1 chr5A.!!$R1 2316
9 TraesCS7B01G487200 chr2B 391170415 391172732 2317 True 4119 4119 98.749 1 2317 1 chr2B.!!$R1 2316
10 TraesCS7B01G487200 chr1B 583567260 583569576 2316 False 4102 4102 98.619 1 2317 1 chr1B.!!$F1 2316

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
676 677 0.679505 GGTTTGGAAGGCTTTGACCC 59.32 55.0 0.0 0.0 0.0 4.46 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1601 1607 2.423538 CTCAGGGTAAATGCTTTTCCCG 59.576 50.0 18.39 15.17 37.31 5.14 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
124 125 2.103263 GGATCACAGGGCTAAGTCGAAT 59.897 50.000 0.00 0.00 0.00 3.34
125 126 3.432326 GGATCACAGGGCTAAGTCGAATT 60.432 47.826 2.72 2.72 0.00 2.17
159 160 3.689347 TCTTTAGTAGTGAGCCGTACCA 58.311 45.455 0.00 0.00 0.00 3.25
273 274 4.990526 ACACCTTGGAAAAGATCACTGAT 58.009 39.130 0.00 0.00 0.00 2.90
590 591 5.753744 TCGTGAAAATGACAACGCTAAATT 58.246 33.333 0.00 0.00 0.00 1.82
676 677 0.679505 GGTTTGGAAGGCTTTGACCC 59.320 55.000 0.00 0.00 0.00 4.46
904 910 9.850628 GATCCAAATACTTACTATATGTGCGTA 57.149 33.333 0.00 0.00 0.00 4.42
1119 1125 1.612199 GGTTGGTTATTCGTCAGCCCA 60.612 52.381 0.00 0.00 0.00 5.36
1601 1607 1.134670 ACTAGTCATCGCCTTTGAGCC 60.135 52.381 0.00 0.00 0.00 4.70
1731 1737 7.324178 CAAGGACAAGTAGCTAGTTGACTAAT 58.676 38.462 36.62 20.55 38.57 1.73
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
124 125 7.038587 TCACTACTAAAGAAGGTTCTGGCATAA 60.039 37.037 0.00 0.00 37.65 1.90
125 126 6.439375 TCACTACTAAAGAAGGTTCTGGCATA 59.561 38.462 0.00 0.00 37.65 3.14
159 160 0.833949 GCCCTTGCTAGGAGCTAGTT 59.166 55.000 16.43 0.00 45.05 2.24
273 274 5.833406 TTCACACTTTGAAATTGAGCTCA 57.167 34.783 13.74 13.74 41.51 4.26
1119 1125 6.306987 TCTCCTATTTTTCCAAGTGAAAGCT 58.693 36.000 0.00 0.00 43.57 3.74
1314 1320 4.811969 TCAGCGACAACCCTATTCTTTA 57.188 40.909 0.00 0.00 0.00 1.85
1601 1607 2.423538 CTCAGGGTAAATGCTTTTCCCG 59.576 50.000 18.39 15.17 37.31 5.14


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.