Multiple sequence alignment - TraesCS7B01G487000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G487000 chr7B 100.000 3161 0 0 1 3161 742935276 742938436 0 5838
1 TraesCS7B01G487000 chr7B 98.393 3173 39 4 1 3161 716798054 716794882 0 5566
2 TraesCS7B01G487000 chr7B 95.789 3182 93 7 1 3161 139621818 139618657 0 5096
3 TraesCS7B01G487000 chr7B 97.926 1109 20 2 1 1106 698128820 698127712 0 1917
4 TraesCS7B01G487000 chr6B 98.487 3172 32 4 1 3161 128892193 128889027 0 5578
5 TraesCS7B01G487000 chr5B 98.423 3171 39 3 1 3161 713115176 713112007 0 5568
6 TraesCS7B01G487000 chr5B 98.138 3169 49 3 1 3159 713093551 713096719 0 5517
7 TraesCS7B01G487000 chr5B 97.719 2280 35 5 1 2270 127821209 127818937 0 3906
8 TraesCS7B01G487000 chr1B 98.140 3172 47 4 1 3161 583548095 583551265 0 5520
9 TraesCS7B01G487000 chr1B 96.698 3180 74 13 1 3159 49787135 49783966 0 5262
10 TraesCS7B01G487000 chr1B 96.458 3190 78 11 1 3161 49815620 49818803 0 5232
11 TraesCS7B01G487000 chr7A 98.492 2255 27 5 912 3161 60097494 60095242 0 3969
12 TraesCS7B01G487000 chr4B 95.867 2202 80 6 969 3161 310467665 310465466 0 3552
13 TraesCS7B01G487000 chrUn 98.808 1342 15 1 1 1341 246699206 246697865 0 2388


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G487000 chr7B 742935276 742938436 3160 False 5838 5838 100.000 1 3161 1 chr7B.!!$F1 3160
1 TraesCS7B01G487000 chr7B 716794882 716798054 3172 True 5566 5566 98.393 1 3161 1 chr7B.!!$R3 3160
2 TraesCS7B01G487000 chr7B 139618657 139621818 3161 True 5096 5096 95.789 1 3161 1 chr7B.!!$R1 3160
3 TraesCS7B01G487000 chr7B 698127712 698128820 1108 True 1917 1917 97.926 1 1106 1 chr7B.!!$R2 1105
4 TraesCS7B01G487000 chr6B 128889027 128892193 3166 True 5578 5578 98.487 1 3161 1 chr6B.!!$R1 3160
5 TraesCS7B01G487000 chr5B 713112007 713115176 3169 True 5568 5568 98.423 1 3161 1 chr5B.!!$R2 3160
6 TraesCS7B01G487000 chr5B 713093551 713096719 3168 False 5517 5517 98.138 1 3159 1 chr5B.!!$F1 3158
7 TraesCS7B01G487000 chr5B 127818937 127821209 2272 True 3906 3906 97.719 1 2270 1 chr5B.!!$R1 2269
8 TraesCS7B01G487000 chr1B 583548095 583551265 3170 False 5520 5520 98.140 1 3161 1 chr1B.!!$F2 3160
9 TraesCS7B01G487000 chr1B 49783966 49787135 3169 True 5262 5262 96.698 1 3159 1 chr1B.!!$R1 3158
10 TraesCS7B01G487000 chr1B 49815620 49818803 3183 False 5232 5232 96.458 1 3161 1 chr1B.!!$F1 3160
11 TraesCS7B01G487000 chr7A 60095242 60097494 2252 True 3969 3969 98.492 912 3161 1 chr7A.!!$R1 2249
12 TraesCS7B01G487000 chr4B 310465466 310467665 2199 True 3552 3552 95.867 969 3161 1 chr4B.!!$R1 2192
13 TraesCS7B01G487000 chrUn 246697865 246699206 1341 True 2388 2388 98.808 1 1341 1 chrUn.!!$R1 1340

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
871 878 0.921347 GCTCCAGTGTATGCGTTACG 59.079 55.0 0.0 0.0 33.15 3.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2513 2542 2.308866 TCTCCCCTCTTCAATTCCCAAC 59.691 50.0 0.0 0.0 0.0 3.77 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
647 654 1.838112 TCGCTAAACCGGGAGAGTTA 58.162 50.000 6.32 0.0 0.00 2.24
702 709 7.123098 CCAAGGCAAGATATAATATGCATCCAA 59.877 37.037 0.19 0.0 40.51 3.53
806 813 7.126398 GCGATGTTTGGTTATAAGAGAATGTC 58.874 38.462 0.00 0.0 0.00 3.06
871 878 0.921347 GCTCCAGTGTATGCGTTACG 59.079 55.000 0.00 0.0 33.15 3.18
967 988 4.133078 CAGTCTCCTTTCAAAAGTGAGCT 58.867 43.478 12.42 0.0 35.31 4.09
2235 2263 1.700739 TGAACATGGTTCCGGGTACTT 59.299 47.619 0.00 0.0 0.00 2.24
2513 2542 5.521372 TGATAGCTCAAGATCATGTTGTTCG 59.479 40.000 0.00 0.0 0.00 3.95
2741 2770 3.369756 CGCATACGTTTTCTTGCTCCTTA 59.630 43.478 0.00 0.0 32.97 2.69
2857 2887 1.592400 CCTTCGCCACTCCACGTCTA 61.592 60.000 0.00 0.0 0.00 2.59
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
13 14 0.036010 AGCCATTCTCACAACGGGAG 60.036 55.000 0.00 0.00 0.00 4.30
63 70 1.798079 GCGCTACTCGGAAAGTACTGG 60.798 57.143 0.00 0.00 39.55 4.00
647 654 4.617298 CGAAACTTTGAACCCAACACAAGT 60.617 41.667 0.00 0.00 30.88 3.16
702 709 5.967088 ACACTCACGATATTCAGCTAAAGT 58.033 37.500 0.00 0.00 0.00 2.66
806 813 4.706233 CGCGTTTTCTGAAGAGCG 57.294 55.556 16.91 16.91 41.56 5.03
871 878 4.708726 ATGACAAAATGCTAGTTGCCTC 57.291 40.909 0.00 0.00 42.00 4.70
893 900 7.007313 ACGAAACATTCTTTCACGAACTTTA 57.993 32.000 0.00 0.00 0.00 1.85
894 901 5.875930 ACGAAACATTCTTTCACGAACTTT 58.124 33.333 0.00 0.00 0.00 2.66
967 988 4.019860 ACTCCATCTTTTTCAGCTCTGCTA 60.020 41.667 0.00 0.00 36.40 3.49
1645 1671 3.520290 AAAAGTGACCGAGATGCGATA 57.480 42.857 0.00 0.00 44.57 2.92
1646 1672 2.386661 AAAAGTGACCGAGATGCGAT 57.613 45.000 0.00 0.00 44.57 4.58
2048 2076 2.822764 CTACACCTAATTCCAGACCGC 58.177 52.381 0.00 0.00 0.00 5.68
2235 2263 6.428465 TCTCCAAACACAAACGCAATATCTTA 59.572 34.615 0.00 0.00 0.00 2.10
2419 2448 5.665360 TGATGTTCCCACTGATACCTAATCA 59.335 40.000 0.00 0.00 42.48 2.57
2513 2542 2.308866 TCTCCCCTCTTCAATTCCCAAC 59.691 50.000 0.00 0.00 0.00 3.77
2575 2604 3.940852 CCATCTTGATGACGAATTCCACA 59.059 43.478 11.76 0.81 0.00 4.17


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.